CD40 (NM_152854) Human Untagged Clone
CAT#: SC306508
CD40 (untagged)-Human CD40 molecule, TNF receptor superfamily member 5 (CD40), transcript variant 2
"NM_152854" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CD40 |
Synonyms | Bp50; CDW40; p50; TNFRSF5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_152854, the custom clone sequence may differ by one or more nucleotides
ATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTCCATCCAGAACCACCCA CTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGACAGAAACT GGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACC TGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCAACCTAGGGCTTCGGGTCCAGCAGA AGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGA GAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTGCTACAGGGGTTTCTGAT ACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTT GGACAAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTGCCA TCCTCTTGGTGCTGGTCTTTATCAAAAAGGTGGCCAAGAAGCCAACCAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_152854 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_152854.3, NP_690593.1 |
RefSeq Size | 1567 bp |
RefSeq ORF | 612 bp |
Locus ID | 958 |
Cytogenetics | 20q13.12 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Allograft rejection, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Cytokine-cytokine receptor interaction, Primary immunodeficiency, Systemic lupus erythematosus, Toll-like receptor signaling pathway, Viral myocarditis |
Gene Summary | 'This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]' Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (2) contains a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219408 | CD40 (Myc-DDK-tagged)-Human CD40 molecule, TNF receptor superfamily member 5 (CD40), transcript variant 2 |
USD 420.00 |
|
RG219408 | CD40 (GFP-tagged) - Human CD40 molecule, TNF receptor superfamily member 5 (CD40), transcript variant 2 |
USD 460.00 |
|
RC219408L3 | Lenti ORF clone of Human CD40 molecule, TNF receptor superfamily member 5 (CD40), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC219408L4 | Lenti ORF clone of Human CD40 molecule, TNF receptor superfamily member 5 (CD40), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review