ASC2 (PYDC1) (NM_152901) Human Untagged Clone

CAT#: SC306521

PYDC1 (untagged)-Human PYD (pyrin domain) containing 1 (PYDC1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PYDC1
• Synonyms: ASC2; cPOP1; POP1; PYC1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_152901, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAACGAAGCGCGAGGCCATCCTGAAGGTGCTGGAGAACCTGACACCGGAGGAGCTCAAGAAGTTCA
  AGATGAAGCTGGGGACGGTGCCGCTGCGCGAGGGCTTTGAGCGCATCCCGCGGGGCGCGCTCGGGCAGCT
  AGATATCGTGGACCTCACCGACAAGCTGGTCGCCTCCTACTACGAGGACTACGCAGCCGAGCTCGTCGTG
  GCCGTGCTGCGCGACATGCGCATGTTGGAGGAGGCCGCACGGCTGCAGCGGGCTGCGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_152901
• ORF Size: 270 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_152901.3, NP_690865.1
• RefSeq Size: 556
• RefSeq ORF: 270
• Locus ID: 260434
• Protein Pathways: NOD-like receptor signaling pathway
• Gene Summary: Associates with PYCARD/ASC and modulates its ability to collaborate with MEFV/pyrin and NLRP3/cryopyrin in NF-kappa-B and pro-caspase-1 activation. Suppresses kinase activity of NF-kappa-B inhibitor kinase (IKK) complex, expression of NF-kappa-B inducible genes and inhibits NF-kappa-B activation by cytokines and LPS. [UniProtKB/Swiss-Prot Function]