CALHM4 (NM_153036) Human Untagged Clone

CAT#: SC306545

FAM26D (untagged)-Human family with sequence similarity 26, member D (FAM26D)


  "NM_153036" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CALHM4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CALHM4
Synonyms C6orf78; FAM26D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_153036 edited
GCCACCATGCTGGGTTGGATTTTGATCACCTTGGCAACCATTGCTGCCTTAGTCTCCTGC
TGTGTGGCAAAGTGCTGCTCTCCCCTCACCTCTCTGCAACATTGCTACTGGACCAGCCAC
CTCCAGAATGAGAGAGAACTCTTTGAACAAGCAGCAGAGCAGCACTCTCGGCTCCTCATG
ATGCATCGCATAAAGAAGCTATTTGGCTTCATTCCCGGGAGTGAAGACGTCAAACACATC
CGCATTCCTTCTTGTCAGGACTGGAAAGATATTTCAGTACCCACTCTTTTATGCATGGGT
GATGACTTGCAAGGTCACTATAGCTTCCTTGGAAATAGGGTGGATGAGGATAATGAGGAA
GACAGATCAAGAGGTATTGAATTAAAACCTTGA
Restriction Sites Please inquire     
ACCN NM_153036
ORF Size 387 bp
Insert Size 400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_153036.1, NP_694581.1
RefSeq Size 1699
RefSeq ORF 387
Locus ID 221301
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.