EDF1 (NM_153200) Human Untagged Clone
CAT#: SC306554
EDF1 (untagged)-Human endothelial differentiation-related factor 1 (EDF1), transcript variant beta
"NM_153200" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | EDF1 |
Synonyms | CFAP280; EDF-1; MBF1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_153200, the custom clone sequence may differ by one or more nucleotides
ATGGCCGAGAGCGACTGGGACACGGTGACGGTGCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAAT CCAAGCAGGCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAATGGGCTGCTGG CCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGGAGACAGAGGAGCTGCACCAT GACAGGGTGACCCTGGAGGTGGGCAAGGTGATCCAGCAAGGTCGGCAGAGCAAGGGGCTTACGCAGAAGG ACCTGGCCACGAAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCGGACGGGCCATACCCAA TAACCAGGTGCTTGGCAAAATCGAGCGGGCCATTGGTGAGTGTCCCTCCACCCTTCGCCGGGTCCGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_153200 |
ORF Size | 420 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_153200.2, NP_694880.1 |
RefSeq Size | 700 |
RefSeq ORF | 420 |
Locus ID | 8721 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (beta) differs its 3' UTR and 3' coding region, compared to variant alpha. The encoded isoform (beta) has a shorter and distinct C-terminus, compared to isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212036 | EDF1 (Myc-DDK-tagged)-Human endothelial differentiation-related factor 1 (EDF1), transcript variant beta |
USD 98.00 |
|
RG212036 | EDF1 (GFP-tagged) - Human endothelial differentiation-related factor 1 (EDF1), transcript variant beta |
USD 460.00 |
|
RC212036L3 | Lenti ORF clone of Human endothelial differentiation-related factor 1 (EDF1), transcript variant beta, Myc-DDK-tagged |
USD 620.00 |
|
RC212036L4 | Lenti ORF clone of Human endothelial differentiation-related factor 1 (EDF1), transcript variant beta, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review