EDF1 (NM_153200) Human Untagged Clone

CAT#: SC306554

EDF1 (untagged)-Human endothelial differentiation-related factor 1 (EDF1), transcript variant beta


  "NM_153200" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EDF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EDF1
Synonyms CFAP280; EDF-1; MBF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_153200, the custom clone sequence may differ by one or more nucleotides


ATGGCCGAGAGCGACTGGGACACGGTGACGGTGCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAAT
CCAAGCAGGCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAATGGGCTGCTGG
CCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGGAGACAGAGGAGCTGCACCAT
GACAGGGTGACCCTGGAGGTGGGCAAGGTGATCCAGCAAGGTCGGCAGAGCAAGGGGCTTACGCAGAAGG
ACCTGGCCACGAAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCGGACGGGCCATACCCAA
TAACCAGGTGCTTGGCAAAATCGAGCGGGCCATTGGTGAGTGTCCCTCCACCCTTCGCCGGGTCCGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_153200
ORF Size 420 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_153200.2, NP_694880.1
RefSeq Size 700
RefSeq ORF 420
Locus ID 8721
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (beta) differs its 3' UTR and 3' coding region, compared to variant alpha. The encoded isoform (beta) has a shorter and distinct C-terminus, compared to isoform alpha.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.