IQCK (NM_153208) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IQCK |
Synonyms | FLJ20115; FLJ36575; MGC35048 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_153208, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCACCGCGGCAAATCCCCAGCCACATAGTGCGCCTCAAGCCCAGCTGCTCTACAGACTCGTCGT TCACCCGGACGCCGGTGCCCACCGTGTCTCTCGCGTCCCGCGAGCTGCCTGTCTCGTCGTGGCAGGTCAC CGAGCCGTCAAGCAAGAATCTGTGGGAGCAGATCTGCAAGGAGTATGAAGCTGAGCAGCCTCCCTTTCCA GAAGGATATAAAGTCAAACAGGAGCCTGTGATTACGGTTGCGCCAGTAGAGGAAATGCTTTTTCATGGCT TCAGTGCAGAGCACTATTTTCCGGTTTCCCATTTCACCATGATCTCACGTACACCCTGTCCTCAAGATAA ATCGGAAACAATCAACCCAAAAACATGTTCTCCCAAAGAATATTTGGAAACTTTCATCTTTCCTGTTCTG CTTCCCGGAATGGCTAGCCTGCTTCACCAAGCGAAGAAAGAAAAATGTTTTGAGAGGAAAAGAACCAAAT TCATTGCCTGTGATTTTCTGACTGAGTGGTTATACAACCAAAATCCAAAGAGGGCAGGGGAGCCATTCAC AGAATTTTTCTCCATTCCATTTGTGGAGGAGCGGCTAAAGCAACACCCACGGCCGCCAATCCCACTCTCG CTCCTGCTGACAGAAGAGGAAGCAGCCCTCTACATTCAATCCTTCTGGAGAGCCTGTGTGGTTCGCTGTG ATCCTGAGATTCAAGAACTGCGTCAGTGGCAGAAGAAACTTCGCGAGGCCAAGCACATTCACCAGCAAGT CAAAATTTTCTGGGCCAAGCAAGAACAAAAAGTGAAATGCAAAATGGAGGACGATGCAGTACCTGCAGCC AAGATGAAAATTCCATCATCTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_153208 |
ORF Size | 864 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_153208.2, NP_694940.1 |
RefSeq Size | 3497 |
RefSeq ORF | 864 |
Locus ID | 124152 |
Gene Summary | This gene belongs to the IQ motif-containing family of proteins. The IQ motif serves as a binding site for different EF-hand proteins such as calmodulin. This gene was identified as a potential candidate gene for obsessive-compulsive disorder in a genome-wide association study. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206698 | IQCK (Myc-DDK-tagged)-Human IQ motif containing K (IQCK) |
USD 420.00 |
|
RG206698 | IQCK (GFP-tagged) - Human IQ motif containing K (IQCK) |
USD 460.00 |
|
RC206698L3 | Lenti ORF clone of Human IQ motif containing K (IQCK), Myc-DDK-tagged |
USD 620.00 |
|
RC206698L4 | Lenti ORF clone of Human IQ motif containing K (IQCK), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review