IQCK (NM_153208) Human Untagged Clone

CAT#: SC306559

IQCK (untagged)-Human IQ motif containing K (IQCK)


  "NM_153208" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IQCK"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IQCK
Synonyms FLJ20115; FLJ36575; MGC35048
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_153208, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCACCGCGGCAAATCCCCAGCCACATAGTGCGCCTCAAGCCCAGCTGCTCTACAGACTCGTCGT
TCACCCGGACGCCGGTGCCCACCGTGTCTCTCGCGTCCCGCGAGCTGCCTGTCTCGTCGTGGCAGGTCAC
CGAGCCGTCAAGCAAGAATCTGTGGGAGCAGATCTGCAAGGAGTATGAAGCTGAGCAGCCTCCCTTTCCA
GAAGGATATAAAGTCAAACAGGAGCCTGTGATTACGGTTGCGCCAGTAGAGGAAATGCTTTTTCATGGCT
TCAGTGCAGAGCACTATTTTCCGGTTTCCCATTTCACCATGATCTCACGTACACCCTGTCCTCAAGATAA
ATCGGAAACAATCAACCCAAAAACATGTTCTCCCAAAGAATATTTGGAAACTTTCATCTTTCCTGTTCTG
CTTCCCGGAATGGCTAGCCTGCTTCACCAAGCGAAGAAAGAAAAATGTTTTGAGAGGAAAAGAACCAAAT
TCATTGCCTGTGATTTTCTGACTGAGTGGTTATACAACCAAAATCCAAAGAGGGCAGGGGAGCCATTCAC
AGAATTTTTCTCCATTCCATTTGTGGAGGAGCGGCTAAAGCAACACCCACGGCCGCCAATCCCACTCTCG
CTCCTGCTGACAGAAGAGGAAGCAGCCCTCTACATTCAATCCTTCTGGAGAGCCTGTGTGGTTCGCTGTG
ATCCTGAGATTCAAGAACTGCGTCAGTGGCAGAAGAAACTTCGCGAGGCCAAGCACATTCACCAGCAAGT
CAAAATTTTCTGGGCCAAGCAAGAACAAAAAGTGAAATGCAAAATGGAGGACGATGCAGTACCTGCAGCC
AAGATGAAAATTCCATCATCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_153208
ORF Size 864 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_153208.2, NP_694940.1
RefSeq Size 3497
RefSeq ORF 864
Locus ID 124152
Gene Summary This gene belongs to the IQ motif-containing family of proteins. The IQ motif serves as a binding site for different EF-hand proteins such as calmodulin. This gene was identified as a potential candidate gene for obsessive-compulsive disorder in a genome-wide association study. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.