DEFB119 (NM_153323) Human Untagged Clone

CAT#: SC306584

DEFB119 (untagged)-Human defensin, beta 119 (DEFB119), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DEFB119
• Synonyms: DEFB-19; DEFB-20; DEFB20; DEFB120; ESC42-RELA; ESC42-RELB
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153323, the custom clone sequence may differ by one or more nucleotides
  ATGAAACTTCTTTACCTGTTTCTTGCCATCCTTCTGGCCATAGAAGAACCAGTGATATCA
  GTAGAGTGTTGGATGGATGGACACTGCCGGTTGTTGTGCAAAGATGGTGAAGACAGCATC
  ATACGCTGCCGAAATCGTAAACGGTGCTGTGTTCCTAGTCGTTATTTAACAATCCAACCA
  GTAACAATTCATGGAATCCTTGGCTGGACCACTCCTCAGATGTCCACAACAGCTCCAAAA
  ATGAAGACAAATATAACTAATAGATAG
  
• Restriction Sites: Please inquire
• ACCN: NM_153323
• ORF Size: 267 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153323.3, NP_697018.1
• RefSeq Size: 467
• RefSeq ORF: 267
• Locus ID: 245932
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the beta subfamily of defensins. Beta-defensins are antimicrobial peptides that protect tissues and organs from infection by a variety of microorganisms. This gene is found in a cluster with other beta-defensin genes on the long arm of chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (3) encodes the longest isoform (c). Isoform c is thought to be an antimicrobial peptide.