PITX2 (NM_153427) Human Untagged Clone

CAT#: SC306602

PITX2 (untagged)-Human paired-like homeodomain 2 (PITX2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PITX2
• Synonyms: ARP1; ASGD4; Brx1; IDG2; IGDS; IGDS2; IHG2; IRID2; Otlx2; PTX2; RGS; RIEG; RIEG1; RS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153427, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGACCAACTGCCGCAAACTGGTGTCGGCGTGTGTGCAATTAGAGAAAGATAAAAGCCAGCAGGGGA
  AGAATGAGGACGTGGGCGCCGAGGACCCGTCTAAGAAGAAGCGGCAAAGGCGGCAGCGGACTCACTTTAC
  CAGCCAGCAGCTCCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCGGACATGTCCACACGCGAA
  GAAATCGCTGTGTGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGTCGGGCCAAAT
  GGAGAAAGAGGGAGCGCAACCAGCAGGCCGAGCTATGCAAGAATGGCTTCGGGCCGCAGTTCAATGGGCT
  CATGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGGGCCGCCAAGGGCCTTACATCC
  GCCTCCCTATCCACCAAGAGCTTCCCCTTCTTCAACTCTATGAACGTCAACCCCCTGTCATCACAGAGCA
  TGTTTTCCCCACCCAACTCTATCTCGTCCATGAGCATGTCGTCCAGCATGGTGCCCTCAGCAGTGACAGG
  CGTCCCGGGCTCCAGTCTCAACAGCCTGAATAACTTGAACAACCTGAGTAGCCCGTCGCTGAATTCCGCG
  GTGCCGACGCCTGCCTGTCCTTACGCGCCGCCGACTCCTCCGTATGTTTATAGGGACACGTGTAACTCGA
  GCCTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTGCAGAACCCGGC
  CTCCAACCTGAGTGCTTGCCAGTATGCAGTGGACCGGCCCGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_153427
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_153427.2, NP_700476.1
• RefSeq Size: 3110 bp
• RefSeq ORF: 816 bp
• Locus ID: 5308
• Cytogenetics: 4q25
• Protein Families: Transcription Factors
• Protein Pathways: TGF-beta signaling pathway
• Gene Summary: 'This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1), also known as ARP1a, lacks an in-frame exon in the 5' region, as compared to variant 2. The resulting isoform (a) lacks an internal segment, as compared to isoform b. Variants 1 and 6 encode the same isoform a.