TAB1 (NM_153497) Human Untagged Clone

CAT#: SC306622

TAB1 (untagged)-Human TGF-beta activated kinase 1/MAP3K7 binding protein 1 (TAB1), transcript variant beta


  "NM_153497" in other vectors (4)

Reconstitution Protocol

USD 770.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TAB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAB1
Synonyms 3'-Tab1; MAP3K7IP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_153497, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGACAGATGACCTGCCTCTCT
GCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACTCTGCTGATGGCAAGGGCACTGAGAGCCA
CCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAACAACTGCTTCCTGTATGGGGTCTTCAACGGC
TATGATGGCAACCGAGTGACCAACTTCGTGGCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGA
ATGCCGAGCACGCCGAGGCCGATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTT
CCTGGAGTCCATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCT
CAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGGGAAATTTCGG
GAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTCGCCAATGTCGGTACAAACCG
TGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTGACACAGCTGAACGTGGACCACACCACAGAG
AACGAGGATGAGCTCTTCCGTCTTTCGCAGCTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCA
TCTGTGGGCAGGAGAGCACCCGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCT
TCTCAGCGCTGCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGCTGGATGGG
GTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCCCATGGGCCTGGGC
AGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAGACCTCCCTGGACGCAGTGGC
CCAGGCCGTCGTGGACCGGGTGAAGCGCATCCACAGCGACACCTTCGCCAGTGGTGGGGAGCGTGCCAGG
TTCTGCCCCCGGCACGAGGACATGACCCTGCTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCC
AGCCCACACCGAGCCCAGCCCCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGC
CCAGAGCACCAGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGGTCAACGGG
GCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAAAGACCCTTCCAGGCCTGCAAGCG
ATTTGACAGCCATCCCTCAGTGCCAACTAAACCTCCTGGGCAGCCTGACCCCAGGGTAG


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_153497
ORF Size 1389 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_153497.2, NP_705717.1
RefSeq Size 1994
RefSeq ORF 1389
Locus ID 10454
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, NOD-like receptor signaling pathway, Toll-like receptor signaling pathway
Gene Summary The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (beta) uses an alternate exon at the 3' end compared to variant 1, which includes a part of the coding region. The resulting isoform (beta) has a distinct and shorter C-terminus, as compared to isoform alpha. The beta isoform can interact with and activate MAPK14/p38alpha, but it does not bind or activate MAP3K7/TAK1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.