HOXA3 (NM_153631) Human Untagged Clone

CAT#: SC306629

HOXA3 (untagged)-Human homeobox A3 (HOXA3), transcript variant 2


  "NM_153631" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HOXA3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HOXA3
Synonyms HOX1; HOX1E
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_153631, the custom clone sequence may differ by one or more nucleotides


ATGCAAAAAGCGACCTACTACGACAGCTCGGCGATCTACGGTGGCTACCCCTACCAGGCAGCCAACGGGT
TCGCTTATAATGCCAATCAGCAGCCGTACCCGGCGTCCGCCGCTTTGGGCGCCGACGGCGAGTACCACCG
ACCCGCCTGCTCCCTCCAGTCTCCCTCCAGCGCCGGGGGCCACCCCAAGGCACACGAACTGAGTGAGGCG
TGCCTGCGCACCCTGAGCGCCCCACCTAGCCAGCCTCCAAGCCTGGGAGAGCCGCCCCTGCACCCGCCGC
CGCCCCAGGCCGCGCCCCCTGCCCCACAGCCGCCTCAGCCCGCACCTCAGCCCCCTGCACCTACCCCTGC
CGCGCCCCCGCCTCCCTCTTCTGCCTCCCCTCCTCAGAATGCCAGCAACAACCCTACCCCTGCCAACGCG
GCCAAGAGCCCCCTGCTCAACTCACCCACAGTGGCCAAACAAATCTTCCCCTGGATGAAAGAGTCTCGAC
AAAACACAAAGCAGAAAACCAGCAGCTCCAGCTCAGGCGAAAGCTGCGCTGGCGACAAGAGCCCGCCGGG
GCAGGCTTCGTCCAAGCGCGCGCGCACGGCCTACACGAGCGCGCAGCTGGTGGAGCTGGAGAAAGAGTTC
CACTTCAACCGCTACCTGTGCCGGCCGCGCCGGGTGGAGATGGCCAATCTGCTGAACCTCACTGAGCGCC
AGATCAAGATCTGGTTCCAGAATCGCCGCATGAAGTACAAAAAGGATCAGAAGGGCAAGGGCATGCTAAC
GTCATCGGGGGGCCAGTCTCCAAGTCGCAGCCCCGTGCCCCCCGGAGCCGGTGGCTATCTGAACTCTATG
CATTCGCTGGTCAACAGCGTCCCGTATGAGCCCCAGTCGCCCCCGCCCTTCTCCAAGCCCCCCCAGGGTA
CCTACGGGCTGCCCCCCGCCTCCTACCCTGCGTCCCTGCCCAGCTGCGCACCCCCGCCACCCCCACAGAA
GCGCTACACGGCGGCAGGGGCGGGCGCAGGGGGCACCCCCGACTATGACCCGCACGCTCATGGCCTGCAG
GGCAACGGCAGCTATGGGACCCCACACATACAGGGAAGCCCCGTCTTCGTGGGGGGCAGCTATGTGGAGC
CCATGAGCAACTCCGGGCCAGCCCTCTTTGGTCTAACTCACCTCCCCCACGCTGCCTCGGGCGCCATGGA
CTATGGGGGTGCCGGGCCGCTGGGCAGCGGCCACCACCACGGGCCGGGGCCTGGGGAGCCGCACCCCACC
TACACGGACCTTACCGGCCACCATCCTTCTCAGGGAAGAATTCAGGAAGCACCCAAGCTCACCCACCTGT
GA


Restriction Sites SgfI-MluI     
ACCN NM_153631
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153631.2, NP_705895.1
RefSeq Size 3396 bp
RefSeq ORF 1332 bp
Locus ID 3200
Cytogenetics 7p15.2
Protein Families Transcription Factors
Gene Summary 'In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.