PANK2 (NM_153640) Human Untagged Clone

CAT#: SC306633

PANK2 (untagged)-Human pantothenate kinase 2 (PANK2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PANK2
• Synonyms: C20orf48; HARP; HSS; NBIA1; PKAN
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153640, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTGCTTTTATTCAAATGGGCAGAGATAAAAACTTCTCGAGTCTCCACACTGTCTTTTGTGCCACTG
  GAGGTGGAGCGTACAAATTTGAGCAGGATTTTCTCACAATAGGTGATCTTCAGCTTTGCAAACTGGATGA
  ACTAGATTGCTTGATCAAAGGAATTTTATACATTGACTCAGTCGGATTCAATGGACGGTCACAGTGCTAT
  TACTTTGAAAACCCTGCTGATTCTGAAAAGTGTCAGAAGTTACCATTTGATTTGAAAAATCCGTATCCTC
  TGCTTCTGGTGAACATTGGCTCAGGGGTTAGCATCTTAGCAGTATATTCCAAAGATAATTACAAACGGGT
  CACAGGTACTAGTCTTGGAGGAGGAACTTTTTTTGGTCTCTGCTGTCTTCTTACTGGCTGTACCACTTTT
  GAAGAAGCTCTTGAAATGGCATCTCGTGGAGATAGCACCAAAGTGGATAAACTAGTACGAGATATTTATG
  GAGGGGACTATGAGAGGTTTGGACTGCCAGGCTGGGCTGTGGCTTCAAGCTTTGGAAACATGATGAGCAA
  GGAGAAGCGAGAGGCTGTCAGTAAAGAGGACCTGGCCAGAGCGACTTTGATCACCATCACCAACAACATT
  GGCTCAATAGCAAGAATGTGTGCCCTTAATGAAAACATTAACCAGGTGGTATTTGTTGGAAATTTCTTGA
  GAATTAATACGATCGCCATGCGGCTTTTGGCATATGCTTTGGATTATTGGTCCAAGGGGCAGTTGAAAGC
  ACTTTTTTCGGAACACGAGGGTTATTTTGGAGCTGTTGGAGCACTCCTTGAGCTGTTGAAGATCCCGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_153640
• ORF Size: 840 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153640.3, NP_705904.1
• RefSeq Size: 7817
• RefSeq ORF: 840
• Locus ID: 80025
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Pantothenate and CoA biosynthesis
• Gene Summary: This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) has an alternate first exon, and uses a downstream translation initiation site, compared to variant 1. The resulting protein (isoform 2) lacks an N-terminal segment compared to isoform 1, resulting in a shorter protein that shares identity through the C-terminus. Isoform 2 is not expressed in mitochondria. Variants 2, 3 and 7 encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.