GSTA5 (NM_153699) Human Untagged Clone

CAT#: SC306643

GSTA5 (untagged)-Human glutathione S-transferase alpha 5 (GSTA5)


  "NM_153699" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GSTA5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSTA5
Synonyms glutathione S-transferase A5; glutathione S-transferase alpha 5; glutathione transferase A5; OTTHUMP00000016610
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_153699 edited
GAGACTGCTATCATGGCAGAGAAGCCCAAGCTCCACTACTCCAATGCACGGGGCAGTATG
GAGTCCATTCGGTGGCTCCTGGCTGCAGCTGGAGTAGAGTTGGAAGAGAAATTTCTAGAA
TCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGGAGTTTGCTGTTCCAGCAAGTACCA
ATGGTTGAGATTGACGGGATGAAGCTGGTGCAGACCAGAGCCATTCTTAACTACATTGCC
AGCAAATACAACCTTTATGGGAAAGACATGAAGGAGAGAGCCCTGATTGATATGTACACA
GAAGGTATAGTAGATTTGACTGAAATGATCCTTCTTCTGCTCATATGTCAACCAGAGGAA
AGAGATGCCAAGACTGCCTTGGTCAAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTT
GAAAAAGTCTTAAAGAGCCACAGACAAGACTACCTTGTTGGCAACAAGCTGAGCTGGGCT
GACATTCACCTGGTGGAACTTTTCTACTACGTGGAAGAGCTTGACTCGAGTCTTATCTCC
AGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACGGTGAAGAAG
TTTCTGCAGCCTGGCAGCCAGAGAAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCA
AGGAAGATTTTCAGGTTTTAA
Restriction Sites Please inquire     
ACCN NM_153699
ORF Size 669 bp
Insert Size 700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation ORF was fully sequenced and the DNA sequence matches with that of NM_153699.1.MG2606_G03 and G07 are also correct. Pool 10 ug of DNA and ship it to the customer.
Reference Data
RefSeq NM_153699.1, NP_714543.1
RefSeq Size 845
RefSeq ORF 669
Locus ID 221357
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary The glutathione S-transferases (GST; EC 2.5.1.18) catalyze the conjugation of reduced glutathiones and a variety of electrophiles, including many known carcinogens and mutagens. The cytosolic GSTs belong to a large superfamily, with members located on different chromosomes. For additional information on GSTs, see GSTA1 (MIM 138359). [supplied by OMIM, Sep 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.