IL19 (NM_153758) Human Untagged Clone

CAT#: SC306657

IL19 (untagged)-Human interleukin 19 (IL19), transcript variant 1


  "NM_153758" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IL19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL19
Synonyms IL-10C; MDA1; NG.1; ZMDA1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_153758, the custom clone sequence may differ by one or more nucleotides
ATGTGCACTGAGGGAGCGTTTCCGCACAGATCTGCGTGTTCCTTACCACTCACACATGTG
CACACACATATCCATGTGTGTGTGCCAGTGCTTTGGGGCTCTGTTCCACGGGGCATGAAG
TTACAGTGTGTTTCCCTTTGGCTCCTGGGTACAATACTGATATTGTGCTCAGTAGACAAC
CACGGTCTCAGGAGATGTCTGATTTCCACAGACATGCACCATATAGAAGAGAGTTTCCAA
GAAATCAAAAGAGCCATCCAAGCTAAGGACACCTTCCCAAATGTCACTATCCTGTCCACA
TTGGAGACTCTGCAGATCATTAAGCCCTTAGATGTGTGCTGCGTGACCAAGAACCTCCTG
GCGTTCTACGTGGACAGGGTGTTCAAGGATCATCAGGAGCCAAACCCCAAAATCTTGAGA
AAAATCAGCAGCATTGCCAACTCTTTCCTCTACATGCAGAAAACTCTGCGGCAATGTCAG
GAACAGAGGCAGTGTCACTGCAGGCAGGAAGCCACCAATGCCACCAGAGTCATCCATGAC
AACTATGATCAGCTGGAGGTCCACGCTGCTGCCATTAAATCCCTGGGAGAGCTCGACGTC
TTTCTAGCCTGGATTAATAAGAATCATGAAGTAATGTTCTCAGCTTGA
Restriction Sites Please inquire     
ACCN NM_153758
ORF Size 648 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_153758.1, NP_715639.1
RefSeq Size 1030
RefSeq ORF 648
Locus ID 29949
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.