IL19 (NM_153758) Human Untagged Clone

CAT#: SC306657

IL19 (untagged)-Human interleukin 19 (IL19), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL19
• Synonyms: IL-10C; MDA1; NG.1; ZMDA1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153758, the custom clone sequence may differ by one or more nucleotides
  ATGTGCACTGAGGGAGCGTTTCCGCACAGATCTGCGTGTTCCTTACCACTCACACATGTG
  CACACACATATCCATGTGTGTGTGCCAGTGCTTTGGGGCTCTGTTCCACGGGGCATGAAG
  TTACAGTGTGTTTCCCTTTGGCTCCTGGGTACAATACTGATATTGTGCTCAGTAGACAAC
  CACGGTCTCAGGAGATGTCTGATTTCCACAGACATGCACCATATAGAAGAGAGTTTCCAA
  GAAATCAAAAGAGCCATCCAAGCTAAGGACACCTTCCCAAATGTCACTATCCTGTCCACA
  TTGGAGACTCTGCAGATCATTAAGCCCTTAGATGTGTGCTGCGTGACCAAGAACCTCCTG
  GCGTTCTACGTGGACAGGGTGTTCAAGGATCATCAGGAGCCAAACCCCAAAATCTTGAGA
  AAAATCAGCAGCATTGCCAACTCTTTCCTCTACATGCAGAAAACTCTGCGGCAATGTCAG
  GAACAGAGGCAGTGTCACTGCAGGCAGGAAGCCACCAATGCCACCAGAGTCATCCATGAC
  AACTATGATCAGCTGGAGGTCCACGCTGCTGCCATTAAATCCCTGGGAGAGCTCGACGTC
  TTTCTAGCCTGGATTAATAAGAATCATGAAGTAATGTTCTCAGCTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_153758
• ORF Size: 648 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153758.1, NP_715639.1
• RefSeq Size: 1030
• RefSeq ORF: 648
• Locus ID: 29949
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
• Gene Summary: The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.