MLX (NM_170607) Human Untagged Clone

CAT#: SC306675

MLX (untagged)-Human MAX-like protein X (MLX), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MLX
• Synonyms: bHLHd13; MAD7; MXD7; TCFL4; TF4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_170607 edited
  CCGGTGGGTACAAGATGACGGAGCCGGGCGCCTCTCCCGAGGACCCTTGGGTCAAGGCAA
  GCCCCGTGGGCGCGCACGCCGGCGAGGGGAGGGCGGGTCGGGCTCGTGCACGTAGGGGGG
  CCGGAAGACGAGGGGCTTCCCTCCTGTCCCCAAAGTCCCCCACGCTCTCCGTGCCCCGGG
  GCTGCAGAGAAGACAGCTCTCACCCCGCGTGTGCCAAGGTGGAGTATGCCTACAGCGACA
  ACAGCCTGGACCCCGGGCTTTTTGTAGAAAGCACCCGCAAGGGGAGTGTAGTGTCCAGAG
  CTAATAGCATCGGTTCCACCAGTGCCTCTTCTGTCCCCAACACAGATGATGAGGACAGTG
  ATTACCACCAGGAGGCCTACAAGGAGTCCTACAAAGACCGGCGGCGGCGCGCACACACTC
  AGGCTGAGCAGAAGAGGAGGGACGCCATCAAGAGAGGCTATGATGACCTTCAGACCATCG
  TCCCCACTTGCCAGCAGCAGGACTTCTCCATTGGCTCCCAAAAGCTCAGCAAAGCCATCG
  TTCTACAAAAGACCATTGACTACATTCAGTTTTTGCACAAGGAGAAGAAAAAGCAGGAGG
  AGGAGGTGTCCACGTTACGCAAGGATGTCACCGCCCTAAAGATCATGAAAGTGAACTATG
  AGCAGATTGTGAAGGCACACCAGGACAACCCCCATGAAGGGGAGGACCAGGTCTCTGACC
  AGGTCAAGTTCAACGTGTTTCAAGGCATCATGGATTCCCTGTTCCAGTCCTTCAATGCCT
  CCATCTCAGTGGCCAGCTTCCAGGAGCTGTCAGCATGTGTCTTCAGCTGGATCGAGGAGC
  ACTGTAAGCCTCAGACCCTGCGGGAGATTGTGATTGGCGTCCTGCACCAATTGAAAAACC
  AGCTTTACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_170607
• Insert Size: 900 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found the protein coded by this clone is identical to NM_170607.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_170607.2, NP_733752.1
• RefSeq Size: 2568 bp
• RefSeq ORF: 897 bp
• Locus ID: 6945
• Cytogenetics: 17q21.2
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'The product of this gene belongs to the family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors. These factors form heterodimers with Mad proteins and play a role in proliferation, determination and differentiation. This gene product may act to diversify Mad family function by its restricted association with a subset of the Mad family of transcriptional repressors, namely, Mad1 and Mad4. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) contains two additional segments in the coding region compared to variant 1. The resulting isoform (gamma) thus, is longer than isoform alpha encoded by variant 1.