CRISP1 (NM_170609) Human Untagged Clone

CAT#: SC306676

CRISP1 (untagged)-Human cysteine-rich secretory protein 1 (CRISP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRISP1
• Synonyms: AEGL1; ARP; CRISP-1; HEL-S-57; HSCRISP1D; HSCRISP1G; HUMARP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_170609, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAATTAAACACCTCTTGTTTTTGGTTGCTGCTGCTTGCTTACTGCCTATGTTGTCCATGAAAAAGA
  AATCAGCTAGAGACCAATTTAATAAGCTCGTCACCGACTTGCCAAATGTACAAGAAGAGATCGTTAATAT
  ACACAACGCCCTCAGGAGAAGAGTAGTTCCACCAGCCAGCAACATGCTGAAGATGAGTTGGAGTGAAGAG
  GCTGCACAAAATGCCAGAATTTTTTCAAAGTATTGTGATATGACAGAGAGCAACCCCCTTGAGAGGAGAC
  TTCCAAATACCTTTTGTGGAGAAAATATGCATATGACATCTTATCCTGTATCATGGTCAAGTGTAATTGG
  AGTCTGGTACAGTGAGTCTACAAGTTTCAAACATGGAGAATGGACAACAACGGATGATGACATAACTACT
  GACCACTACACTCAGATTGTTTGGGCCACATCTTACCTGATTGGCTGTGCCATTGCATCTTGCCGCCAAC
  AAGGATCACCTCGATATCTCTACGTTTGTCACTATTGTCATGACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_170609
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_170609.1, NP_733758.1
• RefSeq Size: 1803 bp
• RefSeq ORF: 537 bp
• Locus ID: 167
• Cytogenetics: 6p12.3
• Gene Summary: 'Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]'
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region compared to variant 1. This results in a frame-shift, early translation termination, and a shorter isoform (2, also known as CRISP-1 delta) compared to isoform 1.