MSI2 (NM_170721) Human Untagged Clone
CAT#: SC306686
MSI2 (untagged)-Human musashi homolog 2 (Drosophila) (MSI2), transcript variant 2
"NM_170721" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MSI2 |
Synonyms | MSI2H |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_170721 edited
ATGGCCGATCTGACATCGGTGCTCACTTCTGTTATGTTTTCTCCCTCTAGTAAAATGTTT ATCGGTGGACTGAGCTGGCAGACCTCACCAGATAGCCTTAGAGACTATTTTAGCAAATTT GGAGAAATTAGAGAATGTATGGTCATGAGAGATCCCACTACGAAACGCTCCAGAGGCTTC GGTTTCGTCACGTTCGCAGACCCAGCAAGTGTAGATAAAGTATTAGGTCAGCCCCACCAT GAGTTAGATTCCAAGACGATTGACCCCAAAGTTGCATTTCCTCGTCGAGCGCAACCCAAG ATGGTCACGAGAACAAAGAAAATATTTGTAGGCGGGTTATCTGCGAACACAGTAGTGGAA GATGTAAAGCAATATTTCGAGCAGTTTGGCAAGGTGGAAGATGCAATGCTGATGTTTGAT AAAACTACCAACAGGCACAGAGGGTTTGGCTTTGTCACTTTTGAGAATGAAGATGTTGTG GAGAAAGTCTGTGAGATTCATTTCCATGAAATCAATAATAAAATGGTAGAATGTAAGAAA GCTCAGCCGAAAGAAGTCATGTTCCCACCTGGGACAAGAGGCCGGGCCCGGGGACTGCCT TACACCATGGACGCGTTCATGCTTGGCATGGGGATGCTGGGATATCCCAACTTCGTGGCG ACCTATGGCCGTGGCTACCCCGGATTTGCTCCAAGCTATGGCTATCAGTTCCCAGACTAT TTGCCGGTTTCACAAGACATAATTTTTATCAACTAG |
Restriction Sites | Please inquire |
ACCN | NM_170721 |
ORF Size | 756 bp |
Insert Size | 800 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_170721.1, NP_733839.1 |
RefSeq Size | 2151 |
RefSeq ORF | 756 |
Locus ID | 124540 |
Gene Summary | This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (2) differs in the 5' and 3' UTR and coding region, compared to variant 1. The resulting isoform (b) contains distinct N- and C-termini compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216799 | MSI2 (Myc-DDK-tagged)-Human musashi homolog 2 (Drosophila) (MSI2), transcript variant 2 |
USD 98.00 |
|
RG216799 | MSI2 (GFP-tagged) - Human musashi homolog 2 (Drosophila) (MSI2), transcript variant 2 |
USD 460.00 |
|
RC216799L1 | Lenti ORF clone of Human musashi homolog 2 (Drosophila) (MSI2), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC216799L2 | Lenti ORF clone of Human musashi homolog 2 (Drosophila) (MSI2), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC216799L3 | Lenti ORF clone of Human musashi homolog 2 (Drosophila) (MSI2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC216799L4 | Lenti ORF clone of Human musashi homolog 2 (Drosophila) (MSI2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review