RNF39 (NM_170769) Human Untagged Clone

CAT#: SC306697

RNF39 (untagged)-Human ring finger protein 39 (RNF39), transcript variant 2


  "NM_170769" in other vectors (4)

Reconstitution Protocol

USD 600.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNF39"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNF39
Synonyms HZF; HZFW; LIRF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_170769, the custom clone sequence may differ by one or more nucleotides


ATGTGGTGGAGAGATTTGACGAGACTGAGACTCTGGTTGAAGAGAGAGGCAATCCCAGGAGAGGGGCGGA
AAGCGGCAAAAGTTAATGCGGGAGTCGGAGAGAAGGGCATCTACACAGCAAGCAGCAGGGGCGGCCCGCC
ATCTGCGCGCTCGAAGGCGGTCACGGTGGTCGCGGAAGGGGCGGCGTCCAGATCCTGGCTTTCCATGGAT
GCGCCCGAGCTGGGCCCGGGGCTGGTGGAGCGTCTGGAGCAGCTGGCGACGTGTCCTCTGTGCGGGGGCT
CCTTCGAGGACCCGGTGCTTCTGGCGTGCGAGCACAGCTTCTGCCGCGCGTGTCTGGCCCGCCGCTGGGG
GACTCCGCCGGCGACCGGCACCGAGGCTTCCCCCACCGCCTGTCCCTGCTGCGGCCTGCCGTGTCCCCGC
CGCAGCCTGAGGTCTAATGTGCGGCTGGCGGTGGAGGTGCGAATCAGCCGCGAGCTGCGAGAGAAGCTGG
CTGAGCCTGGGGCCCGTGCGGGGAGACGCCGAGGGGGGCGCATCCCCACCATGGGCTGCCTGGACCTGCC
CGGAGAGGATATGAGGAAGACATGGAGACGATTTGAAGTCCCAACATCCAAGTCATCTAATTCAGAGGAT
GATCTCCCTGAAGATTATCCAGTGGTCAAAAAAATGCTTCATAGACTGACAGCCGACCTGACCCTGGACC
CTGGGACCGCACACCGCCGCCTGCTCATCTCCGCCGACCGCCGCAGCGTACAACTGGCCCCACCAGGGAC
GCCCGCGCCCCCTGACGGCCCCAAGCGCTTCGATCAGCTCCCAGCTGTGCTGGGTGCGCAGGGCTTCGGG
GCCGGCCGCCACTGCTGGGAGGTGGAGACTGCGGACGCCGCCTCCTGCAGAGACTCTTCTGGGGAGGATG
CGGACGACGAGGAGAGCCACTATGCAGTGGGCGCGGCCGGGGAATCAGTGCAACGCAAGGGCTGCGCGCC
TGGCCCCCTGGGGGAGCGCATCTTCCCGCTGTTCTGCACCTGCGACCCTCGTGCTCCGCTCCGCATTGTA
CCAGCGGAAAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_170769
ORF Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_170769.2, NP_739575.2
RefSeq Size 1970
RefSeq ORF 1065
Locus ID 80352
Protein Families Druggable Genome
Gene Summary This gene lies within the major histocompatibility complex class I region on chromosome 6. Studies of a similar rat protein suggest that this gene encodes a protein that plays a role in an early phase of synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2), also known as HZFw2, lacks an in-frame segment in the coding region, compared to variant 1. The resulting protein (isoform 2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.