RNF39 (NM_170770) Human Untagged Clone

CAT#: SC306698

RNF39 (untagged)-Human ring finger protein 39 (RNF39), transcript variant 3


Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RNF39"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNF39
Synonyms HZF, HZFW, LIRF, HZFw1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_170770 edited
CTATAAAGCCTGATGTGGTGGAGAGATTTGACGAGACTGAGACTCTGGTTGAAGAGAGAG
GCAATCCCAGGAGAGGGGCGGAAAGCGGCAAAAGTTAATGCGGGAGTCGGAGAGAAGGGC
ATCTACACAGCAAGCAGCAGGGGCGGCCCGCCATCTGCGCGCTCGAAGGCGGTCACGGTG
GTCGCGGAAGGGGCGGCGTCCAGATCCTGGCTTTCCATGGATGCGCCCGAGCTGGGCCCG
GGGCTGGTGGAGCGTCTGGAGCAGCTGGCGACGTGTCCTCTGTGCGGGGGCTCCTTCGAG
GACCCGGTGCTTCTGGCGTGCGAGCACAGCTTCTGCCGCGCGTGTCTGGCCCGCCGCTGG
GGGACTCCGCCGGCGACCGGCACCGAGGCTTCCCCCACCGCCTGTCCCTGCTGCGGCCTG
CCGTGTCCCCGCCGCAGCCTGAGGTCTAATGTGCGGCTGGCGGTGGAGGTGCGAATCAGC
CGCGAGCTGCTTTTTGGGGGTGGAATTCCCCACTCATTTCTGGGAACACATTCACACGCC
CATTGCAGGAGTATTAATAGCAACCCACATTTTCGCCCCAAAATAATGAGACCTCACCTG
GTCTCCACGTTTCCACGTCCCTGCTCAAAACCAAATCCATTCCTGCCTTCTGGCTCTCAG
AATCTTCTCTCCCCTACAGCTACTACAGTACTTCCTGACTTCTCCCATTCAAACCATTCT
AGGCCTGCAATGGGGAACAGGCCCTCCCCATCAGTATTGGTAAAGTGA
Restriction Sites Please inquire     
ACCN NM_170770
ORF Size 1353 bp
Insert Size 800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_170770.1.
Reference Data
RefSeq NM_170770.1, NP_739576.1
RefSeq Size 1353
RefSeq ORF 1353
Locus ID 80352
Protein Families Druggable Genome
Gene Summary This gene lies within the major histocompatibility complex class I region on chromosome 6. Studies of a similar rat protein suggest that this gene encodes a protein that plays a role in an early phase of synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses alternate splice sites in the coding region which results in a frameshift and an early stop codon, compared to variant 1. Isoform 3 is shorter and has a distinct C-terminus compared to isoform 1.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.