WFDC13 (NM_172005) Human Untagged Clone
CAT#: SC306704
WFDC13 (untagged)-Human WAP four-disulfide core domain 13 (WFDC13)
"NM_172005" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WFDC13 |
Synonyms | C20orf138; dJ601O1.3; WAP13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_172005, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCTGTGCTGCCTCTCCAGTTCCTGGTGGTGTTCTGCCTAGCACTGCAGCTGGTGCCTGGGAGTC CCAAGCAGCGTGTTCTGAAGTATATCTTGGAACCTCCACCCTGCATATCAGCACCTGAAAACTGTACTCA CCTGTGTACAATGCAGGAAGATTGCGAGAAAGGATTTCAGTGCTGTTCCTCCTTCTGTGGGATAGTCTGT TCATCAGAAACATTTCAAAAGCGCAACAGAATCAAACACAAGGGCTCAGAAGTCATCATGCCTGCCAACT GA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_172005 |
ORF Size | 282 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_172005.1, NP_742002.1 |
RefSeq Size | 1372 |
RefSeq ORF | 282 |
Locus ID | 164237 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223807 | WFDC13 (Myc-DDK-tagged)-Human WAP four-disulfide core domain 13 (WFDC13) |
USD 420.00 |
|
RG223807 | WFDC13 (GFP-tagged) - Human WAP four-disulfide core domain 13 (WFDC13) |
USD 460.00 |
|
RC223807L3 | Lenti ORF clone of Human WAP four-disulfide core domain 13 (WFDC13), Myc-DDK-tagged |
USD 620.00 |
|
RC223807L4 | Lenti ORF clone of Human WAP four-disulfide core domain 13 (WFDC13), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review