IL28A (IFNL2) (NM_172138) Human Untagged Clone
CAT#: SC306725
IFNL2 (untagged)-Human interleukin 28A (interferon, lambda 2) (IL28A)
"NM_172138" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFNL2 |
Synonyms | IL-28A; IL28A |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_172138 edited
CCCTGGGTGACAGCCTCAGAGTGTTTCTTCTGCTGACAAAGACCAGAGATCAGGAATGAA ACTAGACATGACTGGGGACTGCACGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGT GACTGGAGCAGTTCCTGTCGCCAGGCTCCACGGGGCTCTCCCGGATGCAAGGGGCTGCCA CATAGCCCAGTTCAAGTCCCTGTCTCCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGA TGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGCAGGTGCCACTCCCGCCTCTTCCCCAG GACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCATGGCTTTGGAGGCTGAGCT GGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTGGTGGACGT CTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGTTCCGGGCCTGTATCCA GCCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGTACCGGCT CCAGGAGGCCCCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCT CTTCCGCCTCCTCACGCGAGACCTGAATTGTGTTGCCAGTGGGGACCTGTGTGTCTGACC CTCCCACCAGTCATGCAA |
Restriction Sites | Please inquire |
ACCN | NM_172138 |
ORF Size | 603 bp |
Insert Size | 700 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172138.1. |
Reference Data | |
RefSeq | NM_172138.1, NP_742150.1 |
RefSeq Size | 734 |
RefSeq ORF | 603 |
Locus ID | 282616 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28B (IL28B), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221206 | IFNL2 (Myc-DDK-tagged)-Human interleukin 28A (interferon, lambda 2) (IL28A) |
USD 420.00 |
|
RG221206 | IFNL2 (GFP-tagged) - Human interleukin 28A (interferon, lambda 2) (IL28A) |
USD 460.00 |
|
RC221206L1 | Lenti ORF clone of Human interleukin 28A (interferon, lambda 2) (IL28A), Myc-DDK-tagged |
USD 768.00 |
|
RC221206L2 | Lenti ORF clone of Human interleukin 28A (interferon, lambda 2) (IL28A), mGFP tagged |
USD 620.00 |
|
RC221206L3 | Lenti ORF clone of Human interleukin 28A (interferon, lambda 2) (IL28A), Myc-DDK-tagged |
USD 620.00 |
|
RC221206L4 | Lenti ORF clone of Human interleukin 28A (interferon, lambda 2) (IL28A), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review