IL28A (IFNL2) (NM_172138) Human Untagged Clone

CAT#: SC306725

IFNL2 (untagged)-Human interleukin 28A (interferon, lambda 2) (IL28A)


  "NM_172138" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "IFNL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IFNL2
Synonyms IL-28A; IL28A
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_172138 edited
CCCTGGGTGACAGCCTCAGAGTGTTTCTTCTGCTGACAAAGACCAGAGATCAGGAATGAA
ACTAGACATGACTGGGGACTGCACGCCAGTGCTGGTGCTGATGGCCGCAGTGCTGACCGT
GACTGGAGCAGTTCCTGTCGCCAGGCTCCACGGGGCTCTCCCGGATGCAAGGGGCTGCCA
CATAGCCCAGTTCAAGTCCCTGTCTCCACAGGAGCTGCAGGCCTTTAAGAGGGCCAAAGA
TGCCTTAGAAGAGTCGCTTCTGCTGAAGGACTGCAGGTGCCACTCCCGCCTCTTCCCCAG
GACCTGGGACCTGAGGCAGCTGCAGGTGAGGGAGCGCCCCATGGCTTTGGAGGCTGAGCT
GGCCCTGACGCTGAAGGTTCTGGAGGCCACCGCTGACACTGACCCAGCCCTGGTGGACGT
CTTGGACCAGCCCCTTCACACCCTGCACCATATCCTCTCCCAGTTCCGGGCCTGTATCCA
GCCTCAGCCCACGGCAGGGCCCAGGACCCGGGGCCGCCTCCACCATTGGCTGTACCGGCT
CCAGGAGGCCCCAAAAAAGGAGTCCCCTGGCTGCCTCGAGGCCTCTGTCACCTTCAACCT
CTTCCGCCTCCTCACGCGAGACCTGAATTGTGTTGCCAGTGGGGACCTGTGTGTCTGACC
CTCCCACCAGTCATGCAA
Restriction Sites Please inquire     
ACCN NM_172138
ORF Size 603 bp
Insert Size 700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172138.1.
Reference Data
RefSeq NM_172138.1, NP_742150.1
RefSeq Size 734
RefSeq ORF 603
Locus ID 282616
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28B (IL28B), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.