CD8B (NM_172213) Human Untagged Clone

CAT#: SC306742

CD8B (untagged)-Human CD8b molecule (CD8B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD8B
• Synonyms: CD8B1; LEU2; LY3; LYT3; P37
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172213, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGGCCGCGGCTGTGGCTCCTCTTGGCCGCGCAGCTGACAGTTCTCCATGGCAACTCAGTCCTCCAGC
  AGACCCCTGCATACATAAAGGTGCAAACCAACAAGATGGTGATGCTGTCCTGCGAGGCTAAAATCTCCCT
  CAGTAACATGCGCATCTACTGGCTGAGACAGCGCCAGGCACCGAGCAGTGACAGTCACCACGAGTTCCTG
  GCCCTCTGGGATTCCGCAAAAGGGACTATCCACGGTGAAGAGGTGGAACAGGAGAAGATAGCTGTGTTTC
  GGGATGCAAGCCGGTTCATTCTCAATCTCACAAGCGTGAAGCCGGAAGACAGTGGCATCTACTTCTGCAT
  GATCGTCGGGAGCCCCGAGCTGACCTTCGGGAAGGGAACTCAGCTGAGTGTGGTTGATTTCCTTCCCACC
  ACTGCCCAGCCCACCAAGAAGTCCACCCTCAAGAAGAGAGTGTGCCGGTTACCCAGGCCAGAGACCCAGA
  AGGGCCCACTTTGTAGCCCCATCACCCTTGGCCTGCTGGTGGCTGGCGTCCTGGTTCTGCTGGTTTCCCT
  GGGAGTGGCCATCCACCTGTGCTGCCGGCGGAGGAGAGCCCGGCTTCGTTTCATGAAACAGCCTCAAGGG
  GAAGGTATATCAGGAACCTTTGTCCCCCAATGCCTGCATGGATACTACAGCAATACTACAACCTCACAGA
  AGCTGCTTAACCCATGGATCCTGAAAACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_172213
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_172213.3, NP_757362.1
• RefSeq Size: 1071 bp
• RefSeq ORF: 732 bp
• Locus ID: 926
• Cytogenetics: 2p11.2
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Antigen processing and presentation, Cell adhesion molecules (CAMs), Hematopoietic cell lineage, Primary immunodeficiency, T cell receptor signaling pathway
• Gene Summary: 'The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. [provided by RefSeq, May 2010]'
  Transcript Variant: This variant (2) encodes the longest isoform (2).