IL17E (IL25) (NM_172314) Human Untagged Clone

CAT#: SC306752

IL25 (untagged)-Human interleukin 25 (IL25), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL25
• Synonyms: IL17E
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172314, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACCAGGTGGTTGCATTCTTGGCAATGGTCATGGGAACCCACACCTACAGCCACTGGCCCAGCTGCT
  GCCCCAGCAAAGGGCAGGACACCTCTGAGGAGCTGCTGAGGTGGAGCACTGTGCCTGTGCCTCCCCTAGA
  GCCTGCTAGGCCCAACCGCCACCCAGAGTCCTGTAGGGCCAGTGAAGATGGACCCCTCAACAGCAGGGCC
  ATCTCCCCCTGGAGATATGAGTTGGACAGAGACTTGAACCGGCTCCCCCAGGACCTGTACCACGCCCGTT
  GCCTGTGCCCGCACTGCGTCAGCCTACAGACAGGCTCCCACATGGACCCCCGGGGCAACTCGGAGCTGCT
  CTACCACAACCAGACTGTCTTCTACCGGCGGCCATGCCATGGCGAGAAGGGCACCCACAAGGGCTACTGC
  CTGGAGCGCAGGCTGTACCGTGTTTCCTTAGCTTGTGTGTGTGTGCGGCCCCGTGTGATGGGCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_172314
• ORF Size: 486 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_172314.1, NP_758525.1
• RefSeq Size: 1187
• RefSeq ORF: 486
• Locus ID: 64806
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses an alternate start codon, compared to variant 1. The resulting isoform (2) has a distinct N-terminus and is shorter than isoform 1.