OTX2 (NM_172337) Human Untagged Clone

CAT#: SC306753

OTX2 (untagged)-Human orthodenticle homeobox 2 (OTX2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OTX2
• Synonyms: CPHD6; MCOPS5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_172337, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATGTCTTATCTTAAGCAACCGCCTTACGCAGTCAATGGGCTGAGTCTGACCACTTCGGGTATGGACT
  TGCTGCACCCCTCCGTGGGCTACCCGGCCACCCCCCGGAAACAGCGCCGGGAGAGGACGACGTTCACTCG
  GGCGCAGCTAGATGTGCTGGAAGCACTGTTTGCCAAGACCCGGTACCCAGACATCTTCATGCGAGAGGAG
  GTGGCACTGAAAATCAACTTGCCCGAGTCGAGGGTGCAGGTATGGTTTAAGAATCGAAGAGCTAAGTGCC
  GCCAACAACAGCAACAACAGCAGAATGGAGGTCAAAACAAAGTGAGACCTGCCAAAAAGAAGACATCTCC
  AGCTCGGGAAGTGAGTTCAGAGAGTGGAACAAGTGGCCAATTCACTCCCCCCTCTAGCACCTCAGTCCCG
  ACCATTGCCAGCAGCAGTGCTCCTGTGTCTATCTGGAGCCCAGCTTCCATCTCCCCACTGTCAGATCCCT
  TGTCCACCTCCTCTTCCTGCATGCAGAGGTCCTATCCCATGACCTATACTCAGGCTTCAGGTTATAGTCA
  AGGATATGCTGGCTCAACTTCCTACTTTGGGGGCATGGACTGTGGATCATATTTGACCCCTATGCATCAC
  CAGCTTCCCGGACCAGGGGCCACACTCAGTCCCATGGGTACCAATGCAGTCACCAGCCATCTCAATCAGT
  CCCCAGCTTCTCTTTCCACCCAGGGATATGGAGCTTCAAGCTTGGGTTTTAACTCAACCACTGATTGCTT
  GGATTATAAGGACCAAACTGCCTCCTGGAAGCTTAACTTCAATGCTGACTGCTTGGATTATAAAGATCAG
  ACATCCTCGTGGAAATTCCAGGTTTTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_172337
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_172337.2, NP_758840.1
• RefSeq Size: 2118 bp
• RefSeq ORF: 870 bp
• Locus ID: 5015
• Cytogenetics: 14q22.3
• Protein Families: Embryonic stem cells, Induced pluripotent stem cells, Stem cell - Pluripotency, Transcription Factors
• Gene Summary: 'This gene encodes a member of the bicoid subfamily of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and plays a role in brain, craniofacial, and sensory organ development. The encoded protein also influences the proliferation and differentiation of dopaminergic neuronal progenitor cells during mitosis. Mutations in this gene cause syndromic microphthalmia 5 (MCOPS5) and combined pituitary hormone deficiency 6 (CPHD6). This gene is also suspected of having an oncogenic role in medulloblastoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Pseudogenes of this gene are known to exist on chromosomes two and nine. [provided by RefSeq, Jul 2012]'
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks an in-frame segment of the coding region, compared to variant 1, and, compared to isoform a, encodes a shorter isoform (b). Variants 2-4 encode the same protein (isoform b).