IL36 beta (IL36B) (NM_173178) Human Untagged Clone

CAT#: SC306794

IL36B (untagged)-Human interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL36B
• Synonyms: FIL1; FIL1-(ETA); FIL1H; FILI-(ETA); IL-1F8; IL-1H2; IL1-ETA; IL1F8; IL1H2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_173178, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACCCACAACGGGAGGCAGCACCCAAATCCTATGCTATTCGTGATTCTCGACAGATGGTGTGGGTCC
  TGAGTGGAAATTCTTTAATAGCAGCTCCTCTTAGCCGCAGCATTAAGCCTGTCACTCTTCATTTAATAGC
  CTGTAGAGACACAGAATTCAGTGACAAGGAAAAGGGTAATATGGTTTACCTGGGAATCAAGGGAAAAGAT
  CTCTGTCTCTTCTGTGCAGAAATTCAGGGCAAGCCTACTTTGCAGCTTAAGGAAAAAAATATCATGGACC
  TGTATGTGGAGAAGAAAGCACAGAAGCCCTTTCTCTTTTTCCACAATAAAGAAGGCTCCACTTCTGTCTT
  TCAGTCAGTCTCTTACCCTGGCTGGTTCATAGCCACCTCCACCACATCAGGACAGCCCATCTTTCTCACC
  AAGGAGAGAGGCATAACTAATAACACTAACTTCTACTTAGATTCTGTGGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_173178
• ORF Size: 474 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_173178.2, NP_775270.1
• RefSeq Size: 1068
• RefSeq ORF: 474
• Locus ID: 27177
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 3' region, which includes a part of the coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.