IL36 beta (IL36B) (NM_173178) Human Untagged Clone

CAT#: SC306794

IL36B (untagged)-Human interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 2


  "NM_173178" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IL36B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL36B
Synonyms FIL1; FIL1-(ETA); FIL1H; FILI-(ETA); IL-1F8; IL-1H2; IL1-ETA; IL1F8; IL1H2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_173178, the custom clone sequence may differ by one or more nucleotides


ATGAACCCACAACGGGAGGCAGCACCCAAATCCTATGCTATTCGTGATTCTCGACAGATGGTGTGGGTCC
TGAGTGGAAATTCTTTAATAGCAGCTCCTCTTAGCCGCAGCATTAAGCCTGTCACTCTTCATTTAATAGC
CTGTAGAGACACAGAATTCAGTGACAAGGAAAAGGGTAATATGGTTTACCTGGGAATCAAGGGAAAAGAT
CTCTGTCTCTTCTGTGCAGAAATTCAGGGCAAGCCTACTTTGCAGCTTAAGGAAAAAAATATCATGGACC
TGTATGTGGAGAAGAAAGCACAGAAGCCCTTTCTCTTTTTCCACAATAAAGAAGGCTCCACTTCTGTCTT
TCAGTCAGTCTCTTACCCTGGCTGGTTCATAGCCACCTCCACCACATCAGGACAGCCCATCTTTCTCACC
AAGGAGAGAGGCATAACTAATAACACTAACTTCTACTTAGATTCTGTGGAATAA


Restriction Sites SgfI-MluI     
ACCN NM_173178
ORF Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_173178.2, NP_775270.1
RefSeq Size 1068
RefSeq ORF 474
Locus ID 27177
Protein Families Druggable Genome, Secreted Protein
Gene Summary The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' region, which includes a part of the coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.