IL37 (NM_173203) Human Untagged Clone
CAT#: SC306802
IL37 (untagged)-Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 3
"NM_173203" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL37 |
Synonyms | FIL1; FIL1(ZETA); FIL1Z; IL-1F7; IL-1H; IL-1H4; IL-1RP1; IL-37; IL1F7; IL1H4; IL1RP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173203, the custom clone sequence may differ by one or more nucleotides
ATGTCCTTTGTGGGGGAGAACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGATGAACCCCAGT GCTGCTTAGAAGAGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCAGCCTCTGCGGAGAAAGGAAGTCC GATTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTACTGTGACAAGGATAAAGGACAAAGTCATCCA TCCCTTCAGCTGAAGAAGGAGAAACTGATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCA TCTTTTATAGGGCTCAGGTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTCATCTG CACCTCCTGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGGAAACACATTGAATTT TCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTCAGCGATTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_173203 |
ORF Size | 474 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_173203.1, NP_775295.1 |
RefSeq Size | 604 |
RefSeq ORF | 474 |
Locus ID | 27178 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine can bind to, and may be a ligand for interleukin 18 receptor (IL18R1/IL-1Rrp). This cytokine also binds to interleukin 18 binding protein (IL18BP), an inhibitory binding protein of interleukin 18 (IL18), and subsequently forms a complex with IL18 receptor beta subunit, and through which it inhibits the activity of IL18. This gene along with eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks two consecutive exons but maintains the reading frame, compared to variant 1, resulting an isoform (3) that lacks an internal region, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222125 | IL37 (Myc-DDK-tagged)-Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 3 |
USD 420.00 |
|
RG222125 | IL37 (GFP-tagged) - Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 3 |
USD 460.00 |
|
RC222125L3 | Lenti ORF clone of Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC222125L4 | Lenti ORF clone of Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review