IL37 (NM_173204) Human Untagged Clone

CAT#: SC306803

IL37 (untagged)-Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL37
• Synonyms: FIL1; FIL1(ZETA); FIL1Z; IL-1F7; IL-1H; IL-1H4; IL-1RP1; IL-37; IL1F7; IL1H4; IL1RP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_173204, the custom clone sequence may differ by one or more nucleotides
  ATGTCCTTTGTGGGGGAGAACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGAT
  GAACCCCAGTGCTGCTTAGAAGACCCGGCTGGAAGCCCCCTGGAACCAGGCCCAAGCCTC
  CCCACCATGAATTTTGTTCACACAAAGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCA
  GCCTCTGCGGAGAAAGGAAGTCCGATTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTC
  TACTGTGACAAGGATAAAGGACAAAGTCATCCATCCCTTCAGCTGAAGAAGGAGAAACTG
  ATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTTTATAGGGCTCAG
  GTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTCATCTGCACCTCC
  TGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGGAAACACATTGAA
  TTTTCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTCAGCGATTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_173204
• ORF Size: 537 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_173204.1, NP_775296.1
• RefSeq Size: 667
• RefSeq ORF: 537
• Locus ID: 27178
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine can bind to, and may be a ligand for interleukin 18 receptor (IL18R1/IL-1Rrp). This cytokine also binds to interleukin 18 binding protein (IL18BP), an inhibitory binding protein of interleukin 18 (IL18), and subsequently forms a complex with IL18 receptor beta subunit, and through which it inhibits the activity of IL18. This gene along with eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) lacks an in-frame coding exon, compared to variant 1, resulting an isoform (4) that lacks an internal region, as compared to isoform 1.