PHF7 (NM_173341) Human Untagged Clone
CAT#: SC306808
PHF7 (untagged)-Human PHD finger protein 7 (PHF7), transcript variant 2
"NM_173341" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PHF7 |
Synonyms | HSPC045; HSPC226; NYD-SP6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173341, the custom clone sequence may differ by one or more nucleotides
ATGAAGACTGTAAAAGAAAAGAAGGAATGCCAGAGATTGAGAAAATCTGCCAAGACTAGGAGGGTAACCC AGAGGAAACCGTCTTCAGGGCCTGTTTGCTGGCTATGCCTTCGAGAACCTGGGGATCCCGAAAAATTAGG GGAATTTCTTCAGAAAGACAATATCAGCGTGCATTATTTCTGTCTTATCTTATCTAGTAAGCTGCCTCAG AGGGGCCAGTCCAACAGAGGCTTCCATGGATTTCTGCCTGAAGACATCAAAAAGGAGGCAGCCCGGGCTT CTAGGAAGATCTGCTTTGTGTGCAAGAAAAAGGGAGCTGCTATCAACTGCCAGAAGGATCAGTGCCTCAG AAACTTCCATCTGCCTTGTGGCCAAGAAAGGGGTTGCCTTTCACAATTTTTTGGAGAGTACAAATCATTT TGTGACAAACATCGCCCAACACAGAACATCCAACATGGGCATGTGGGGGAGGAAAGCTGCATCTTATGTT GTGAAGACTTATCCCAACAGAGTGTTGAGAACATCCAGAGCCCGTGTTGTAGTCAAGCCATCTACCACCG CAAGTGCATACAGAAATATGCCCACACATCAGCAAAGCATTTCTTCAAATGTCCACAGTGTAACAATCGA AAAGAGTTTCCTCAAGAAATGCTGAGAATGGGAATTCATATTCCAGACAGGAGGTGGTGCCTCATTCTGT GTGCTACATGCGGATCCCACGGAACCCACAGGGACTGCTCCTCTCTTAGATCTAACAGTAAGAAATGGGA GTGTGAGGAGTGTTCACCTGCTGCAGCCACAGACTACATACCTGAAAACTCAGGGGACATCCCTTGCTGC AGCAGCACCTTCCACCCTGAGGAACATTTCTGCAGAGACAACACCTTGGAAGAGAATCCGGGCCTTTCTT GGACTGATTGGCCAGAACCTTCCTTATTAGAAAAGCCAGAGTCCTCTCGTGGCAGGAGGAGCTACTCCTG GAGGTCCAAGGGTGTCAGAATCACTAACAGCTGCAAAAAATCCAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_173341 |
ORF Size | 1029 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_173341.1, NP_775463.1 |
RefSeq Size | 2173 |
RefSeq ORF | 1029 |
Locus ID | 51533 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in isoform 2 which is 39 amino acids shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219026 | PHF7 (Myc-DDK-tagged)-Human PHD finger protein 7 (PHF7), transcript variant 2 |
USD 420.00 |
|
RG219026 | PHF7 (GFP-tagged) - Human PHD finger protein 7 (PHF7), transcript variant 2 |
USD 460.00 |
|
RC219026L3 | Lenti ORF clone of Human PHD finger protein 7 (PHF7), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC219026L4 | Lenti ORF clone of Human PHD finger protein 7 (PHF7), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review