ARHGAP27 (NM_174919) Human Untagged Clone

CAT#: SC306956

ARHGAP27 (untagged)-Human Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3


  "NM_174919" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARHGAP27"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARHGAP27
Synonyms CAMGAP1; PP905; SH3D20; SH3P20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_174919, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGACGTGGTGGGGGACGTGTACGTGCTGGTGGAGCACCCCTTCGAGTACACCGGCAAGGACG
GGCGCCGCGTGGCCATCCGGCCGAATGAGCGCTACCGGCTGCTGCGGCGCAGCACCGAGCACTGGTGGCA
CGTGCGGCGTGAGCCCGGCGGCCGCCCCTTCTACCTGCCTGCGCAGTACGTGCGCGAGCTGCCCGCGCTG
GGCAACCCTGCCGCCGCCGCGCCGCCAGGTCCCCACCCGAGCCCCGCGGCCCCTGAGCCGCTCGCCTACG
ACTACCGGTTTGTGAGCGCGGCGGCGACCGCGGGCCCCGACGGCGCCCCCGAGGAGTCCGGAGGCCGAGC
CAGCTCCCTGTGCGGCCCTGCGCAACGCGGCGCCGCGACCCAGCGCAGCAGCCTGGCGCCCGGCCTGCCA
GCCTGCCTGTACCTGCGGCCCGCGGCGCCCGTGCGGCCCGCGCAGTCCCTGAACGACCTGGCCTGCGCCG
CCGTCTCGCCTCCCGCCGGCCTCCTAGGAAGCAGCGGCAGCTTCAAGGCCTGCAGCGTGGCGGGCTCCTG
GGTGTGCCCGCGGCCTCTGGCGCGCAGCGACTCAGAGAACGTCTACGAGGTCATCCAGGACTTGCACGTC
CCGCCGCCGGAGGAGAGCGCAGAGCAGGTACCTCCCCGGGCGCTGGGGCGCGGAGGCGGGTGGCGCGCTA
GGGACCGCGCCCGCACGGAGCCGGGGCGCAAGGAGACCCGCTCCGCTCAGCGTCGGGCACGACGCCCACC
TCTGTCCGAAGACTTCGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_174919
ORF Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_174919.3, NP_777579.2
RefSeq Size 1394
RefSeq ORF 792
Locus ID 201176
Gene Summary This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may pay a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (3) is a short variant at the 5' end of a much longer ARHGAP27 gene, and differs in the UTRs and CDS compared to variant 4. The encoded isoform (c) is shorter than isoform d. CCDS Note: This CCDS represents a short variant at the 5' end of a much longer ARHGAP27 gene. The protein includes an SH3 domain.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.