ARHGAP27 (NM_174919) Human Untagged Clone
CAT#: SC306956
ARHGAP27 (untagged)-Human Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3
"NM_174919" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ARHGAP27 |
Synonyms | CAMGAP1; PP905; SH3D20; SH3P20 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_174919, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGGACGTGGTGGGGGACGTGTACGTGCTGGTGGAGCACCCCTTCGAGTACACCGGCAAGGACG GGCGCCGCGTGGCCATCCGGCCGAATGAGCGCTACCGGCTGCTGCGGCGCAGCACCGAGCACTGGTGGCA CGTGCGGCGTGAGCCCGGCGGCCGCCCCTTCTACCTGCCTGCGCAGTACGTGCGCGAGCTGCCCGCGCTG GGCAACCCTGCCGCCGCCGCGCCGCCAGGTCCCCACCCGAGCCCCGCGGCCCCTGAGCCGCTCGCCTACG ACTACCGGTTTGTGAGCGCGGCGGCGACCGCGGGCCCCGACGGCGCCCCCGAGGAGTCCGGAGGCCGAGC CAGCTCCCTGTGCGGCCCTGCGCAACGCGGCGCCGCGACCCAGCGCAGCAGCCTGGCGCCCGGCCTGCCA GCCTGCCTGTACCTGCGGCCCGCGGCGCCCGTGCGGCCCGCGCAGTCCCTGAACGACCTGGCCTGCGCCG CCGTCTCGCCTCCCGCCGGCCTCCTAGGAAGCAGCGGCAGCTTCAAGGCCTGCAGCGTGGCGGGCTCCTG GGTGTGCCCGCGGCCTCTGGCGCGCAGCGACTCAGAGAACGTCTACGAGGTCATCCAGGACTTGCACGTC CCGCCGCCGGAGGAGAGCGCAGAGCAGGTACCTCCCCGGGCGCTGGGGCGCGGAGGCGGGTGGCGCGCTA GGGACCGCGCCCGCACGGAGCCGGGGCGCAAGGAGACCCGCTCCGCTCAGCGTCGGGCACGACGCCCACC TCTGTCCGAAGACTTCGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_174919 |
ORF Size | 792 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_174919.3, NP_777579.2 |
RefSeq Size | 1394 |
RefSeq ORF | 792 |
Locus ID | 201176 |
Gene Summary | This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may pay a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (3) is a short variant at the 5' end of a much longer ARHGAP27 gene, and differs in the UTRs and CDS compared to variant 4. The encoded isoform (c) is shorter than isoform d. CCDS Note: This CCDS represents a short variant at the 5' end of a much longer ARHGAP27 gene. The protein includes an SH3 domain. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209629 | ARHGAP27 (Myc-DDK-tagged)-Human Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3 |
USD 98.00 |
|
RG209629 | ARHGAP27 (GFP-tagged) - Human Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3 |
USD 460.00 |
|
RC209629L3 | Lenti-ORF clone of ARHGAP27 (Myc-DDK-tagged)-Human Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3 |
USD 620.00 |
|
RC209629L4 | Lenti-ORF clone of ARHGAP27 (mGFP-tagged)-Human Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review