RAB3IP (NM_175624) Human Untagged Clone

CAT#: SC307003

RAB3IP (untagged)-Human RAB3A interacting protein (rabin3) (RAB3IP), transcript variant beta 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB3IP
• Synonyms: RABIN3; RABIN8
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_175624, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTAATGATCCCTTGGAAGGCTTCCATGAAGTAAACCTTGCTTCACCTACTTCTCCGGACCTTCTTG
  GTGTGTATGAATCAGGAACTCAAGAGCAGACTACCTCACCAAGTGTCATCTACCGGCCACACCCTTCAGC
  TTTATCCTCTGTACCTATCCAGGCAAATGCATTAGATGTTTCTGAACTTCCTACACAACCCGTGTATTCA
  TCCCCCAGACGTTTAAATTGTGCGGAAATATCTAGTATCAGCTTTCATGTTACAGACCCAGCCCCTTGCT
  CTACCTCTGGAGTCACAGCTGGATTAACTAAATTAACTACAAGAAAGGACAACTATAATGCAGAGAGAGA
  GTTTTTACAGGGTGCTACTATAACAGAGGCTTGCGATGGCAGTGATGATATTTTTGGGTTGAGTACTGAT
  AGTCTGTCTCGTTTACGAAGCCCATCTGTTTTGGAAGTTAGAGAAAAGGGCTATGAACGATTAAAAGAAG
  AACTCGCAAAAGCTCAGAGGGAACTGAAGTTAAAAGATGAAGAATGTGAGAGGCTTTCAAAAGTGCGAGA
  TCAACTTGGACAGGAATTGGAAGAACTCACAGCTAGTCTATTTGAGGAAGCTCATAAAATGGTGAGAGAA
  GCAAATATCAAGCAGGCAACAGCAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATTGATGTACTTCAAG
  CTGAAGTAGCTGCATTGAAGACACTTGTATTGTCCAGTTCTCCAACATCACCTACGCAGGAGCCTTTGCC
  AGGTGGAAAGACACCTTTTAAAAAGGGGCATACAAGAAATAAAAGCACAAGCAGTGCTATGAGTGGCAGT
  CATCAGGACCTCAGTGTGATACAGCCAATTGTAAAAGACTGCAAAGAGGCTGACTTATCCTTGTATAATG
  AATTCCGATTGTGGAAGGATGAGCCCACAATGGACAGGACGTGTCCTTTCTTAGACAAAATCTACCAGGA
  AGATATCTTTCCATGTTTAACATTCTCAAAAAGTGAGTTGGCTTCAGCTGTTCTGGAGGCTGTGGAAAAC
  AATACTCTAAGCATTGAACCAGTGGGATTACAACCTATCCGGTTTGTGAAAGCTTCTGCAGTTGAATGCG
  GAGGACCAAAATCACTTCTGTATGTAACTTTTTTACATACATTCGATACATTCAGCAGGGACTCGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_175624
• ORF Size: 1188 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_175624.3, NP_783323.1
• RefSeq Size: 9417
• RefSeq ORF: 1188
• Locus ID: 117177
• Gene Summary: Guanine nucleotide exchange factor (GEF) which may activate RAB8A and RAB8B. Promotes the exchange of GDP to GTP, converting inactive GDP-bound Rab proteins into their active GTP-bound form. Mediates the release of GDP from RAB8A and RAB8B but not from RAB3A or RAB5. Modulates actin organization and promotes polarized transport of RAB8A-specific vesicles to the cell surface. Together with RAB11A, RAB8A, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (beta 1) has a distinct 5' UTR and multiple coding region differences, compared to variant alpha 2. These differences cause translation initiation at a downstream AUG and a frameshift in the 3' coding region. The resulting isoform (beta 1) is shorter and has a shorter N-terminus and a distinct C-terminus, compared to isoform alpha 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.