RAB3IP (NM_175625) Human Untagged Clone

CAT#: SC307004

RAB3IP (untagged)-Human RAB3A interacting protein (rabin3) (RAB3IP), transcript variant beta 2


  "NM_175625" in other vectors (4)

Reconstitution Protocol

USD 700.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAB3IP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB3IP
Synonyms RABIN3; RABIN8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_175625, the custom clone sequence may differ by one or more nucleotides


ATGGGATTAAAAAAGATGAAAGGGTTATCTTATGATGAGGCTTTTGCTATGGCTAATGATCCCTTGGAAG
GCTTCCATGAAGTAAACCTTGCTTCACCTACTTCTCCGGACCTTCTTGGTGTGTATGAATCAGGAACTCA
AGAGCAGACTACCTCACCAAGTGTCATCTACCGGCCACACCCTTCAGCTTTATCCTCTGTACCTATCCAG
GCAAATGCATTAGATGTTTCTGAACTTCCTACACAACCCGTGTATTCATCCCCCAGACGTTTAAATTGTG
CGGAAATATCTAGTATCAGCTTTCATGTTACAGACCCAGCCCCTTGCTCTACCTCTGGAGTCACAGCTGG
ATTAACTAAATTAACTACAAGAAAGGACAACTATAATGCAGAGAGAGAGTTTTTACAGGGTGCTACTATA
ACAGAGGCTTGCGATGGCAGTGATGATATTTTTGGGTTGAGTACTGATAGTCTGTCTCGTTTACGAAGCC
CATCTGTTTTGGAAGTTAGAGAAAAGGGCTATGAACGATTAAAAGAAGAACTCGCAAAAGCTCAGAGGGA
ACTGAAGTTAAAAGATGAAGAATGTGAGAGGCTTTCAAAAGTGCGAGATCAACTTGGACAGGAATTGGAA
GAACTCACAGCTAGTCTATTTGAGGAAGCTCATAAAATGGTGAGAGAAGCAAATATCAAGCAGGCAACAG
CAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATTGATGTACTTCAAGCTGAAGTAGCTGCATTGAAGAC
ACTTGTATTGTCCAGTTCTCCAACATCACCTACGCAGGAGCCTTTGCCAGGTGGAAAGACACCTTTTAAA
AAGGGGCATACAAGAAATAAAAGCACAAGCAGTGCTATGAGTGGCAGTCATCAGGACCTCAGTGTGATAC
AGCCAATTGTAAAAGACTGCAAAGAGGCTGACTTATCCTTGTATAATGAATTCCGATTGTGGAAGGATGA
GCCCACAATGGACAGGACGTGTCCTTTCTTAGACAAAATCTACCAGGAAGATATCTTTCCATGTTTAACA
TTCTCAAAAAGTGAGTTGGCTTCAGCTGTTCTGGAGGCTGTGGAAAACAATACTCTAAGCATTGAACCAG
TGGGATTACAACCTATCCGGTTTGTGAAAGCTTCTGCAGTTGAATGCGGAGGACCAAAATCACTTCTGTA
TGTAACTTTTTTACATACATTCGATACATTCAGCAGGGACTCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_175625
ORF Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_175625.3, NP_783324.1
RefSeq Size 9551
RefSeq ORF 1236
Locus ID 117177
Gene Summary Guanine nucleotide exchange factor (GEF) which may activate RAB8A and RAB8B. Promotes the exchange of GDP to GTP, converting inactive GDP-bound Rab proteins into their active GTP-bound form. Mediates the release of GDP from RAB8A and RAB8B but not from RAB3A or RAB5. Modulates actin organization and promotes polarized transport of RAB8A-specific vesicles to the cell surface. Together with RAB11A, RAB8A, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (beta 2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant alpha 2. The resulting isoform (beta 2) is shorter and has a distinct C-terminus, compared to isoform alpha 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.