IL5RA (NM_175727) Human Untagged Clone

CAT#: SC307018

IL5RA (untagged)-Human interleukin 5 receptor, alpha (IL5RA), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL5RA
• Synonyms: CD125; CDw125; HSIL5R3; IL5R
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene SC307018 ORF sequence for NM_175727, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCATCGTGGCGCATGTATTACTCATCCTTTTGGGGGCCACTGAGATACTGCAAGCTGACTTACTTC
  CTGATGAAAAGATTTCACTTCTCCCACCTGTCAATTTCACCATTAAAGTTACTGGTTTGGCTCAAGTTCT
  TTTACAATGGAAACCAAATCCTGATCAAGAGCAAAGGAATGTTAATCTAGAATATCAAGTGAAAATAAAC
  GCTCCAAAAGAAGATGACTATGAAACCAGAATCACTGAAAGCAAATGTGTAACCATCCTCCACAAAGGCT
  TTTCAGCAAGTGTGCGGACCATCCTGCAGAACGACCACTCACTACTGGCCAGCAGCTGGGCTTCTGCTGA
  ACTTCATGCCCCACCAGGGTCTCCTGGAACCTCAATTGTGAATTTAACTTGCACCACAAACACTACAGAA
  GACAATTATTCACGTTTAAGGTCATACCAAGTTTCCCTTCACTGCACCTGGCTTGTTGGCACAGATGCCC
  CTGAGGACACGCAGTATTTTCTCTACTATAGGTATGGCTCTTGGACTGAAGAATGCCAAGAATACAGCAA
  AGACACACTGGGGAGAAATATCGCATGCTGGTTTCCCAGGACTTTTATCCTCAGCAAAGGGCGTGACTGG
  CTTGCGGTGCTTGTTAACGGCTCCAGCAAGCACTCTGCTATCAGGCCCTTTGATCAGCTGTTTGCCCTTC
  ACGCCATTGATCAAATAAATCCTCCACTGAATGTCACAGCAGAGATTGAAGGAACTCGTCTCTCTATCCA
  ATGGGAGAAACCAGTGTCTGCTTTTCCAATCCATTGCTTTGATTATGAAGTAAAAATACACAATACAAGG
  AATGGATATTTGCAGATAGAAAAATTGATGACCAATGCATTCATCTCAATAATTGATGATCTTTCTAAGT
  ACGATGTTCAAGTGAGAGCAGCAGTGAGCTCCATGTGCAGAGAGGCAGGGCTCTGGAGTGAGTGGAGCCA
  ACCTATTTATGTGGGTAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_175727
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_175727.1, NP_783854.1
• RefSeq Size: 1983 bp
• RefSeq ORF: 1002 bp
• Locus ID: 3568
• Cytogenetics: 3p26.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
• Gene Summary: 'The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]'
  Transcript Variant: This variant (5) lacks an internal segment within the 5' UTR, and differs in the 3' end region, when compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, as compared to isoform 1.