RAB37 (NM_175738) Human Untagged Clone

CAT#: SC307024

RAB37 (untagged)-Human RAB37, member RAS oncogene family (RAB37), transcript variant 3


  "NM_175738" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAB37"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB37
Synonyms FLJ30284; FLJ32507
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_175738, the custom clone sequence may differ by one or more nucleotides


ATGGACCTGCAGAGACCCGATTCCTACCAGGGAGGAGCTGGCCCTGACTTCAACGACCACGTCCTGCATA
AGACCATCCTGGTGGGTGACAGTGGTGTGGGAAAGACGTCTCTGCTGGTTCAGTTCGATCAGGGCAAGTT
CATCCCCGGCTCCTTCTCGGCCACTGTGGGCATCGGATTCACGAACAAGGTGGTGACTGTGGATGGCGTG
AGAGTGAAGCTGCAGATCTGGGACACCGCTGGGCAGGAACGGTTCCGAAGCGTCACCCATGCTTATTACA
GAGATGCTCAGGCCTTGCTTCTGCTGTATGACATCACCAACAAATCTTCTTTCGACAACATCAGGGCCTG
GCTCACTGAGATTCATGAGTATGCCCAGAGGGACGTGGTGATCATGCTGCTAGGCAACAAGGCGGATATG
AGCAGCGAAAGAGTGATCCGTTCCGAAGACGGAGAGACCTTGGCCAGGGAGTACGGTGTTCCCTTCCTGG
AGACCAGCGCCAAGACTGGCATGAATGTGGAGTTAGCCTTTCTGGCCATCGCCAAGGAACTGAAATACCG
GGCCGGGCATCAGGCGGATGAGCCCAGCTTCCAGATCCGAGACTATGTAGAGTCCCAGAAGAAGCGCTCC
AGCTGCTGCTCCTTCATGTGA


Restriction Sites SgfI-MluI     
ACCN NM_175738
ORF Size 651 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_175738.4, NP_783865.1
RefSeq Size 3091
RefSeq ORF 651
Locus ID 326624
Protein Families Druggable Genome, Secreted Protein
Gene Summary Rab proteins are low molecular mass GTPases that are critical regulators of vesicle trafficking. For additional background information on Rab proteins, see MIM 179508. [supplied by OMIM, Apr 2006]
Transcript Variant: This variant (3) represents the longest transcript and encodes isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.