HNF 4 alpha (HNF4A) (NM_175914) Human Untagged Clone

CAT#: SC307054

HNF4A (untagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 4


  "NM_175914" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "HNF4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HNF4A
Synonyms FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF14
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_175914 edited
ATGGTCAGCGTGAACGCGCCCCTCGGGGCTCCAGTGGAGAGTTCTTACGACACGTCCCCA
TCAGAAGGCACCAACCTCAACGCGCCCAACAGCCTGGGTGTCAGCGCCCTGTGTGCCATC
TGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGCTGTGACGGCTGCAAGGGC
TTCTTCCGGAGGAGCGTGCGGAAGAACCACATGTACTCCTGCAGATTTAGCCGGCAGTGC
GTGGTGGACAAAGACAAGAGGAACCAGTGCCGCTACTGCAGGCTCAAGAAATGCTTCCGG
GCTGGCATGAAGAAGGAAGCCGTCCAGAATGAGCGGGACCGGATCAGCACTCGAAGGTCA
AGCTATGAGGACAGCAGCCTGCCCTCCATCAATGCGCTCCTGCAGGCGGAGGTCCTGTCC
CGACAGATCACCTCCCCCGTCTCCGGGATCAACGGCGACATTCGGGCGAAGAAGATTGCC
AGCATCGCAGATGTGTGTGAGTCCATG:AAGGAGCAGCTGCTGGTTCTCGTTGAGTGGGC
CAAGTACATCCCAGCTTTCTGCGAGCTCCCCCTGGACGACCAGGTGGCCCTGCTCAGAGC
CCATGCTGGCGAGCACCTGCTGCTCGGAGCCACCAAGAGATCCATGGTGTTCAAGGACGT
GCTGCTCCTAGGCAATGACTACATTGTCCCTCGGCACTGCCCGGAGCTGGCGGAGATGAG
CCGGGTGTCCATACGCATCCTTGACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAGATCGA
TGACAATGAGTATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAGGGGCT
GAGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTA
CATCAACGACCGCCAGTATGACTCGCGTGGCCGCTTTGGAGAGCTGCTGCTGCTGCTGCC
CACCTTGCAGAGCATCACCTGGCAGATGATCGAGCAGATCCAGTTCATCAAGCTCTTCGG
CATGGCCAAGATTGACAACCTGTTGCAGGAGATGCTGCTGGGAGGGTCCCCCAGCGATGC
ACCCCATGCCCACCACCCCCTGCACCCTCACCTGATGCAGGAACATATGGGAACCAACGT
CATCGTTGCCAACACAATGCCCACTCACCTCAGCAACGGACAGATGTGTGAGTGGCCCCG
ACCCAGGGGACAGGCAGCCACCCCTGAGACCCCACAGCCCTCACCGCCAGGTGGCTCAGG
GTCTGAGCCCTATAAGCTCCTGCCGGGAGCCGTCGCCACAATCGTCAAGCCCCTCTCTGC
CATCCCCCAGCCGACCATCACCAAGCAGGAAGTTATCTAG
Restriction Sites Please inquire     
ACCN NM_175914
Insert Size 1360 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_175914.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_175914.3, NP_787110.2
RefSeq Size 1369 bp
RefSeq ORF 1359 bp
Locus ID 3172
Cytogenetics 20q13.12
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Maturity onset diabetes of the young
Gene Summary 'The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]'
Transcript Variant: This variant (5) contains an alternate 5' terminal exon, which results in translation initiation from an alternate upstream start codon compared to variant 2. The resulting shorter isoform (5, also known as HNF4alpha8) has a distinct N-terminus compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.