SULT1C2 (NM_176825) Human Untagged Clone

CAT#: SC307073

SULT1C2 (untagged)-Human sulfotransferase family, cytosolic, 1C, member 2 (SULT1C2), transcript variant 2


  "NM_176825" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SULT1C2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SULT1C2
Synonyms humSULTC2; ST1C1; ST1C2; SULT1C1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_176825, the custom clone sequence may differ by one or more nucleotides


ATGGCCCTGACCTCAGACCTGGGGAAACAGATAAAACTGAAAGAGGTGGAGGGGACCCTCCTGCAGCCTG
CAACTGTGGACAACTGGAGCCAGATCCAGAGCTTCGAGGCCAAACCAGATGATCTCCTCATCTGCACCTA
CCCTAAAGCAGGGACAACGTGGATTCAGGAAATTGTGGATATGATTGAACAGAATGGGGACGTGGAGAAG
TGCCAGCGAGCCATCATCCAACACCGCCATCCTTTCATTGAGTGGGCTCGGCCACCCCAACCTTCTGAGA
CAGGATTTCACCATGTTGCCCAGGCTGGTCTCAAACTCCTGAGCTCAAGCAATCCACCTGCCTCAACCTC
CCAAAGTGCCAAGATTACAGACCTGCTGCCACCGTCTTTCTGGGAAAACAACTGCAAGTTCCTTTATGTA
GCTCGAAATGCCAAAGACTGTATGGTTTCCTACTACCATTTCCAAAGGATGAACCACATGCTTCCTGACC
CTGGTACCTGGGAAGAGTATTTTGAAACCTTCATCAATGGAAAAGTGGTTTGGGGTTCCTGGTTTGACCA
CGTGAAAGGATGGTGGGAGATGAAAGACAGACACCAGATTCTCTTCCTCTTCTATGAGGACATAAAGAGG
GACCCAAAGCATGAAATTCGGAAGGTGATGCAGTTCATGGGAAAGAAGGTGGATGAAACAGTGCTAGATA
AAATTGTCCAGGAGACGTCATTTGAGAAAATGAAAGAAAATCCCATGACAAATCGTTCTACAGTTTCCAA
ATCTATCTTGGACCAGTCAATTTCCTCCTTCATGAGAAAAGGAACTGTGGGGGATTGGAAAAACCACTTC
ACTGTTGCCCAGAATGAGAGGTTTGATGAAATCTATAGAAGAAAGATGGAAGGAACCTCCATAAACTTCT
GCATGGAACTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_176825
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_176825.2, NP_789795.1
RefSeq Size 2832 bp
RefSeq ORF 924 bp
Locus ID 6819
Cytogenetics 2q12.3
Gene Summary 'Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) contains one alternate in-frame segment and uses a different splice site in an adjacent exon when compared to variant 1. The resulting isoform (b) is longer with a different internal protein sequence when compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.