SULT1C2 (NM_176825) Human Untagged Clone
CAT#: SC307073
SULT1C2 (untagged)-Human sulfotransferase family, cytosolic, 1C, member 2 (SULT1C2), transcript variant 2
"NM_176825" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SULT1C2 |
Synonyms | humSULTC2; ST1C1; ST1C2; SULT1C1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_176825, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTGACCTCAGACCTGGGGAAACAGATAAAACTGAAAGAGGTGGAGGGGACCCTCCTGCAGCCTG CAACTGTGGACAACTGGAGCCAGATCCAGAGCTTCGAGGCCAAACCAGATGATCTCCTCATCTGCACCTA CCCTAAAGCAGGGACAACGTGGATTCAGGAAATTGTGGATATGATTGAACAGAATGGGGACGTGGAGAAG TGCCAGCGAGCCATCATCCAACACCGCCATCCTTTCATTGAGTGGGCTCGGCCACCCCAACCTTCTGAGA CAGGATTTCACCATGTTGCCCAGGCTGGTCTCAAACTCCTGAGCTCAAGCAATCCACCTGCCTCAACCTC CCAAAGTGCCAAGATTACAGACCTGCTGCCACCGTCTTTCTGGGAAAACAACTGCAAGTTCCTTTATGTA GCTCGAAATGCCAAAGACTGTATGGTTTCCTACTACCATTTCCAAAGGATGAACCACATGCTTCCTGACC CTGGTACCTGGGAAGAGTATTTTGAAACCTTCATCAATGGAAAAGTGGTTTGGGGTTCCTGGTTTGACCA CGTGAAAGGATGGTGGGAGATGAAAGACAGACACCAGATTCTCTTCCTCTTCTATGAGGACATAAAGAGG GACCCAAAGCATGAAATTCGGAAGGTGATGCAGTTCATGGGAAAGAAGGTGGATGAAACAGTGCTAGATA AAATTGTCCAGGAGACGTCATTTGAGAAAATGAAAGAAAATCCCATGACAAATCGTTCTACAGTTTCCAA ATCTATCTTGGACCAGTCAATTTCCTCCTTCATGAGAAAAGGAACTGTGGGGGATTGGAAAAACCACTTC ACTGTTGCCCAGAATGAGAGGTTTGATGAAATCTATAGAAGAAAGATGGAAGGAACCTCCATAAACTTCT GCATGGAACTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_176825 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_176825.2, NP_789795.1 |
RefSeq Size | 2832 bp |
RefSeq ORF | 924 bp |
Locus ID | 6819 |
Cytogenetics | 2q12.3 |
Gene Summary | 'Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) contains one alternate in-frame segment and uses a different splice site in an adjacent exon when compared to variant 1. The resulting isoform (b) is longer with a different internal protein sequence when compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221503 | SULT1C2 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1C, member 2 (SULT1C2), transcript variant 2 |
USD 420.00 |
|
RG221503 | SULT1C2 (GFP-tagged) - Human sulfotransferase family, cytosolic, 1C, member 2 (SULT1C2), transcript variant 2 |
USD 460.00 |
|
RC221503L3 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1C, member 2 (SULT1C2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC221503L4 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1C, member 2 (SULT1C2), transcript variant 2, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review