BHLHA15 (NM_177455) Human Untagged Clone

CAT#: SC307095

BHLHA15 (untagged)-Human basic helix-loop-helix family, member a15 (BHLHA15)


  "NM_177455" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "BHLHA15"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BHLHA15
Synonyms BHLHB8; MIST1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_177455 edited
AGCTCCAAGGGCCTCACCTTCCTGCCGCCACCTCCTAGGACAGCCAGTCCAGGGCCATGA
AGACCAAGAACCGGCCCCCACGGCGCCGGGCCCCGGTGCAGGACACAGAGGCCACCCCCG
GGGAGGGGACGCCCGACGGGTCCCTGCCGAACCCGGGGCCAGAGCCGGCCAAGGGTCTGC
GGAGCCGGCCGGCCCGGGCCGCAGCAAGGGCTCCGGGCGAGGGCAGGCGCAGGCGGCCAG
GACCCTCCGGGCCCGGTGGCCGTCGTGACAGCAGCATCCAGCGGCGGCTGGAGAGCAACG
AGAGGGAGCGGCAGCGGATGCACAAGCTAAATAACGCCTTCCAGGCCCTGCGTGAAGTCA
TCCCCCACGTGCGCGCGGACAAGAAGCTCTCCAAGATCGAGACGCTCACGCTGGCCAAGA
ACTACATCAAATCGCTGACGGCCACCATCCTGACCATGTCCAGCAGCCGCCTCCCAGGCC
TGGAGGGGCCGGGCCCCAAGCTCTACCAGCACTACCAGCAGCAGCAGCAGGTGGCTGGGG
GTGCGTTGGGGGCCACGGAGGCCCAGCCCCAGGGCCACCTGCAGAGGTACTCCACGCAGA
TCCACAGCTTCCGAGAGGGCACCTAGCGCCCAGTCCTGGGTGGGGGTGGCGGTGGCCGCA
GCTGCCTGGCCTGCTCCTCCCAGCCCCAGTCCCTCCAAGCCACGAG
Restriction Sites Please inquire     
ACCN NM_177455
ORF Size 570 bp
Insert Size 700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_177455.2.
Reference Data
RefSeq NM_177455.2, NP_803238.1
RefSeq Size 588
RefSeq ORF 570
Locus ID 168620
Protein Pathways Maturity onset diabetes of the young

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.