TAS1R1 (NM_177541) Human Untagged Clone

CAT#: SC307106

TAS1R1 (untagged)-Human taste receptor, type 1, member 1 (TAS1R1), transcript variant 4


  "NM_177541" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAS1R1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAS1R1
Synonyms candidate taste receptor T1R1; gm148; GPR70; Gpr70; G protein-coupled receptor 70; OTTMUSP00000011121; sweet taste receptor T1r; T1R1; T1r1; taste receptor, type 1, member 1; TR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_177541, the custom clone sequence may differ by one or more nucleotides


ATGCTGCTCTGCACGGCTCGCCTGGTCGGCCTGCAGCTTCTCATTTCCTGCTGCTGGGCCTTTGCCTGCC
ATAGCACGGAGTCTTCTCCTGACTTCACCCTCCCCGGAGATTACCTCCTGGCAGGCCTGTTCCCTCTCCA
TTCTGGCTGTCTGCAGGTGAGGCACAGACCCGAGGTGACCCTGTGTGACAGGTCTTGTAGCTTCAATGAG
CATGGCTACCACCTCTTCCAGGCTATGCGGCTTGGGGTTGAGGAGATAAACAACTCCACGGCCCTGCTGC
CCAACATCACCCTGGGGTACCAGCTGTATGATGTGTGTTCTGACTCTGCCAATGTGTATGCCACGCTGAG
AGTGCTCTCCCTGCCAGGGCAACACCACATAGAGCTCCAAGGAGACCTTCTCCACTATTCCCCTACGGTG
CTGGCAGTGATTGGGCCTGACAGCACCAACCGTGCTGCCACCACAGCCGCCCTGCTGAGCCCTTTCCTGG
TGCCCATGCTTTTGGAGCAGATCCACAAGGTGCATTTCCTTCTACACAAGGACACTGTGGCGTTTAATGA
CAACAGAGATCCCCTCAGTAGCTATAACATAATTGCCTGGGACTGGAATGGACCCAAGTGGACCTTCACG
GTCCTCGGTTCCTCCACATGGTCTCCAGTTCAGCTAAACATAAATGAGACCAAAATCCAGTGGCACGGAA
AGGACAACCAGGTGCCTAAGTCTGTGTGTTCCAGCGACTGTCTTGAAGGGCACCAGCGAGTGGTTACGGG
TTTCCATCACTGCTGCTTTGAGTGTGTGCCCTGTGGGGCTGGGACCTTCCTCAACAAGAGTGCTACCTGG
GTAAGGACTTGCCAGAGAACTACAACGAGGCCAAATGTGTCACCTTCAGCCTGCTCTTCAACTTCGTGTC
CTGGATCGCCTTCTTCACCACGGCCAGCGTCTACGACGGCAAGTACCTGCCTGCGGCCAACATGA


Restriction Sites SgfI-MluI     
ACCN NM_177541
ORF Size 975 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_177541.1, NP_803885.1
RefSeq Size 1302
RefSeq ORF 975
Locus ID 80835
Protein Families Druggable Genome, Transmembrane
Protein Pathways Taste transduction
Gene Summary The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (4) lacks an alternate segment and utilizes an alternate splice site, one of which causes a frameshift compared to variant 2. The resulting isoform (d) is shorter and has a distinct C-terminus compared to isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.