LHFPL1 (NM_178175) Human Untagged Clone

CAT#: SC307139

LHFPL1 (untagged)-Human lipoma HMGIC fusion partner-like 1 (LHFPL1)


  "NM_178175" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "LHFPL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LHFPL1
Synonyms MGC118798; MGC118800; MGC118801
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_178175, the custom clone sequence may differ by one or more nucleotides


ATGAGGAGCAGCCTGACCATGGTGGGAACCCTCTGGGCCTTCCTGTCCCTTGTTACTGCTGTGACCAGTT
CTACCAGTTACTTCCTACCTTACTGGCTCTTTGGATCCCAGATGGGGAAGCCAGTGTCATTCAGCACATT
CCGGAGGTGCAACTACCCTGTGCGGGGAGAGGGACACAGTCTGATCATGGTGGAAGAATGTGGGCGCTAT
GCCAGCTTCAATGCCATCCCAAGCCTGGCCTGGCAGATGTGCACAGTGGTGACAGGTGCCGGCTGTGCTC
TGCTGCTCCTGGTGGCACTAGCTGCTGTCCTGGGTTGCTGCATGGAGGAGCTCATCTCCAGAATGATGGG
ACGTTGCATGGGAGCAGCGCAGTTTGTTGGAGGGCTGCTGATAAGCTCAGGCTGTGCCTTATACCCTTTA
GGATGGAATAGCCCGGAGATAATGCAAACATGTGGGAATGTCTCCAATCAATTTCAGTTAGGTACCTGTC
GGCTTGGCTGGGCCTATTACTGTGCTGGAGGTGGAGCAGCTGCAGCCATGTTGATCTGCACCTGGCTCTC
TTGCTTTGCTGGAAGAAACCCCAAGCCTGTCATATTGGTGGAGAGCATCATGAGGAATACCAATTCTTAT
GCTATGGAGCTTGACCATTGCCTCAAACCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_178175
ORF Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_178175.3, NP_835469.1
RefSeq Size 1765
RefSeq ORF 663
Locus ID 340596
Protein Families Transmembrane
Gene Summary This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.