CMTM1 (NM_181270) Human Untagged Clone

CAT#: SC307250

CMTM1 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 2


  "NM_181270" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CMTM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CMTM1
Synonyms CKLFH; CKLFH1; CKLFSF1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_181270, the custom clone sequence may differ by one or more nucleotides
ATGGATCCTGAACACGCCAAACCTGAGTCATCCGAGGCACCTTCAGGGAACTTGAAACAA
CCGGAGACTGCCGCAGCCCTGAGTCTTATCTTAGGAGCATTAGCTTGTTTCATCATCACC
CAAGCCAATGAGTCATTTATAACAATCACAAGTCTGGAAATCTGCATTGTCGTTTTTTTT
ATTCTAATATATGTGCTAACCCTTCACCACTTGCTGACCTATTTACATTGGCCCTTACTT
GATCTTACCAACAGTATCATTACAGCTGTGTTCCTTTCAGTAGTTGCCATCTTGGCCATG
CAAGAAAAGAAAAGAAGGCATTTACTCTATGTCGGGGGGCGGTAA
Restriction Sites Please inquire     
ACCN NM_181270
ORF Size 345 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_181270.1, NP_851787.1
RefSeq Size 768
RefSeq ORF 345
Locus ID 113540
Protein Families Transmembrane
Gene Summary This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor). [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 17, one of which results in a translational frameshift in the last coding exon. The encoded isoform (2) is shorter and contains a distinct C-terminus, compared to the protein (isoform 13) encoded by variant 17.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.