CMTM1 (NM_181271) Human Untagged Clone

CAT#: SC307251

CMTM1 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CMTM1
• Synonyms: CKLFH; CKLFH1; CKLFSF1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181271, the custom clone sequence may differ by one or more nucleotides
  ATGGATCCTGAACACGCCAAACCTGAGTCATCCGAGGCACCTTCAGGGAACTTGAAACAA
  CCGGAGACTGCCGCAGCCCTGGCAAGTAGCGGCAGCGTAGATCTTACCAACAGTATCATT
  ACAGCTGTGTTCCTTTCAGTAGTTGCCATCTTGGCCATGCAAGAAAAGAAAAGAAGGCAT
  TTACTCTATGTCGGGGGGTCCCTGTGTCTCACAGCGGTAATCGTGTGTTGCATCGATGCG
  TTTGTGGTCACCACGAAGATGAGGACCAACTTGAAAAGATTCCTGGGAGTCGAAGTTGAA
  AGGAAGCTTTCCCCCGCCAAGGACGCCTACCCCGAAACCGGCCCCGACGCCCCGCAGAGG
  CCCGCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_181271
• ORF Size: 369 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181271.1, NP_851788.1
• RefSeq Size: 643
• RefSeq ORF: 369
• Locus ID: 113540
• Protein Families: Transmembrane
• Gene Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor). [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (3) has multiple differences in the coding region but maintains the reading frame, compared to variant 17. The encoded isoform (3) is shorter than the protein (isoform 13) encoded by variant 17.