CMTM1 (NM_181283) Human Untagged Clone
CAT#: SC307253
CMTM1 (untagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 5
"NM_181283" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CMTM1 |
Synonyms | CKLFH; CKLFH1; CKLFSF1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_181283, the custom clone sequence may differ by one or more nucleotides
ATGGATCCTGAACACGCCAAACCTGAGTCATCCGAGGCACCTTCAGGGAACTTGAAACAA CCGGAGACTGCCGCAGCCCTGGATCTTACCAACAGTATCATTACAGCTGTGTTCCTTTCA GTAGTTGCCATCTTGGCCATGCAAGAAAAGAAAAGAAGGCATTTACTCTATGTCGGGGGG CGGTAA |
Restriction Sites | Please inquire |
ACCN | NM_181283 |
ORF Size | 186 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_181283.1, NP_851800.1 |
RefSeq Size | 610 |
RefSeq ORF | 186 |
Locus ID | 113540 |
Protein Families | Transmembrane |
Gene Summary | This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CKLF (chemokine-like factor). [provided by RefSeq, Feb 2011] Transcript Variant: This variant (5) has multiple differences in the coding region, compared to variant 17, one of which results in a translational frameshift in the last coding exon. The encoded isoform (5) is shorter and contains a distinct C-terminus, compared to the protein (isoform 13) encoded by variant 17. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219830 | CMTM1 (Myc-DDK-tagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 5 |
USD 420.00 |
|
RG219830 | CMTM1 (GFP-tagged) - Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 5 |
USD 460.00 |
|
RC219830L3 | Lenti-ORF clone of CMTM1 (Myc-DDK-tagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 5 |
USD 620.00 |
|
RC219830L4 | Lenti-ORF clone of CMTM1 (mGFP-tagged)-Human CKLF-like MARVEL transmembrane domain containing 1 (CMTM1), transcript variant 5 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review