MRPL52 (NM_181307) Human Untagged Clone
CAT#: SC307268
MRPL52 (untagged)-Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 7
"NM_181307" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRPL52 |
Synonyms | mitochondrial ribosomal protein L52; OTTHUMP00000164489 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_181307, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCTTTAGGGACTGTTCTCTTCACAGGTGTCCGGAGGCTGCACTGCAGCGTAGCC GCTTGGGCGGGCGGCCAGTGGCGACTACAGCAGGGACTGGCTGCCAACCCCTCCGGCTAC GGGCCCCTTACCGAGCTCCCAGACTGGTCATATGCGGAGACGAGTTGTACTGCTGTCACA GGAAATGGACGCTGGATTACAAGCATGGCAGCTCAGGCAGCAGAAGTTGCAGGAAGAACA AAGGAAGCAGGAAAATGCTCTTAA |
Restriction Sites | Please inquire |
ACCN | NM_181307 |
ORF Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_181307.1, NP_851824.1 |
RefSeq Size | 1049 |
RefSeq ORF | 264 |
Locus ID | 122704 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein which has no bacterial homolog. Multiple transcript variants encoding different protein isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (7) lacks an alternate segment, compared to variant 1, resulting in a shorter protein (isoform e) with a distinct C-terminus compared to isoform a. The predicted ORF of this transcript has not been experimentally confirmed. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215173 | MRPL52 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 7 |
USD 420.00 |
|
RG215173 | MRPL52 (GFP-tagged) - Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 7 |
USD 460.00 |
|
RC215173L3 | Lenti-ORF clone of MRPL52 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 7 |
USD 620.00 |
|
RC215173L4 | Lenti-ORF clone of MRPL52 (mGFP-tagged)-Human mitochondrial ribosomal protein L52 (MRPL52), nuclear gene encoding mitochondrial protein, transcript variant 7 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review