IL22 RA2 (IL22RA2) (NM_181310) Human Untagged Clone
CAT#: SC307271
IL22RA2 (untagged)-Human interleukin 22 receptor, alpha 2 (IL22RA2), transcript variant 3
"NM_181310" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL22RA2 |
Synonyms | CRF2-10; CRF2-S1; CRF2X; IL-22BP; IL-22R-alpha-2; IL-22RA2; ZCYTOR16 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_181310, the custom clone sequence may differ by one or more nucleotides
ATGATGCCTAAACATTGCTTTCTAGGCTTCCTCATCAGTTTCTTCCTTACTGGTGTAGCAGGAACTCAGT CAACGCATGAGTCTCTGAAGCCTCAGAGGGTACAATTTCAGTCCCGAAATTTTCACAACATTTTGCAATG GCAGCCTGGGAGGGCACTTACTGGCAACAGCAGTGTCTATTTTGTGCAGTACAAAATATATGGACAGAGA CAATGGAAAAATAAAGAAGACTGTTGGGGTACTCAAGAACTCTCTTGTGACCTTACCAGTGAAACCTCAG ACATACAGGAACCTTATTACGGGAGGGTGAGGGCGGCCTCGGCTGGGAGCTACTCAGAATGGAGCATGAC GCCGCGGTTCACTCCCTGGTGGGAAAGAGCAAAAGGTTTATGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_181310 |
ORF Size | 393 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_181310.1, NP_851827.1 |
RefSeq Size | 2644 |
RefSeq ORF | 393 |
Locus ID | 116379 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (3) lacks two alternate exons in the coding region, which leads to a translation frameshift, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215420 | IL22RA2 (Myc-DDK-tagged)-Human interleukin 22 receptor, alpha 2 (IL22RA2), transcript variant 3 |
USD 420.00 |
|
RG215420 | IL22RA2 (GFP-tagged) - Human interleukin 22 receptor, alpha 2 (IL22RA2), transcript variant 3 |
USD 460.00 |
|
RC215420L3 | Lenti-ORF clone of IL22RA2 (Myc-DDK-tagged)-Human interleukin 22 receptor, alpha 2 (IL22RA2), transcript variant 3 |
USD 620.00 |
|
RC215420L4 | Lenti-ORF clone of IL22RA2 (mGFP-tagged)-Human interleukin 22 receptor, alpha 2 (IL22RA2), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review