Integrin beta 4 binding protein (EIF6) (NM_181466) Human Untagged Clone

CAT#: SC307281

EIF6 (untagged)-Human eukaryotic translation initiation factor 6 (EIF6), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EIF6
• Synonyms: b(2)gcn; CAB; eIF-6; EIF3A; ITGB4BP; p27(BBP); p27BBP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181466, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGTCCGAGCTTCGTTCGAGAACAACTGTGAGATCGGCTGCTTTGCCAAGCTCACC
  AACACCTACTGTCTGGTAGCGATCGGAGGCTCAGAGAACTTCTACAGGTGCGGCGGGAGC
  CCCGGGGCTTACGGTGGCGGGGAGGCGTGCGCAGGAGTCAAGAGCTCCGGCAGTGGGAGG
  GTGCCGGCCCCTCTGCCCCGCCACCACCGAGTCCATGTCCCTACAGTGTGTTCGAGGGCG
  AGCTCTCCGATACCATCCCCGTGGTGCACGCGTCTATCGCCGGCTGCCGCATCATCGGGC
  GCATGTGTGTGGGAGACAGAAGAAATTCTGGCAGATGTGCTCAAGGTGGAAGTCTTCAGA
  CAGACAGTGGCCGACCAGGTGCTAGTAGGAAGCTACTGTGTCTTCAGCAATCAGGGAGGG
  CTGGTGCATCCCAAGACTTCAATTGAAGACCAGGATGAGCTGTCCTCTCTTCTTCAAGTC
  CCCCTTGTGGCGGGGACTGTGAACCGAGGCAGTGAGGTGATTGCTGCTGGGATGGTGGTG
  AATGACTGGTGTGCCTTCTGTGGCCTGGACACAACCAGCACAGAGCTGTCAGTGGTGGAG
  AGTGTCTTCAAGCTGAATGAAGCCCAGCCTAGCACCATTGCCACCAGCATGCGGGATTCC
  CTCATTGACAGCCTCACCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_181466
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181466.1, NP_852131.1
• RefSeq Size: 1057 bp
• RefSeq ORF: 681 bp
• Locus ID: 3692
• Cytogenetics: 20q11.22
• Protein Families: Druggable Genome
• Gene Summary: 'Hemidesmosomes are structures which link the basal lamina to the intermediate filament cytoskeleton. An important functional component of hemidesmosomes is the integrin beta-4 subunit (ITGB4), a protein containing two fibronectin type III domains. The protein encoded by this gene binds to the fibronectin type III domains of ITGB4 and may help link ITGB4 to the intermediate filament cytoskeleton. The encoded protein, which is insoluble and found both in the nucleus and in the cytoplasm, can function as a translation initiation factor and prevent the association of the 40S and 60S ribosomal subunits. Multiple non-protein coding transcript variants and variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]'
  Transcript Variant: This variant (4) contains an alternate segment compared to variant 1, which causes a frameshift, and lacks an alternate exon, which corrects the frameshift, compared to variant 1. The resulting isoform (c) lacks an internal segment compared to isoform a.