SPINLW1 (EPPIN) (NM_181502) Human Untagged Clone

CAT#: SC307287

SPINLW1 (untagged)-Human serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin) (SPINLW1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPINLW1
• Synonyms: CT72; dJ461P17.2; EPPIN; EPPIN1; EPPIN2; EPPIN3; WAP7; WFDC7
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181502, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCTCTAAGGCACACGGGTGTAAAACCGCTCTTTCCCTAGGGAGATGTCCCAAAATCAGAGAAGAAT
  GTGAATTCCAAGAAAGGGATGTGTGTACAAAGGACAGACAATGCCAGGACAACAAGAAGTGTTGTGTCTT
  CAGCTGCGGAAAAAAATGTTTAGATCTCAAACAAGATGTATGCGAAATGCCAAAAGAAACTGGCCCCTGC
  CTGGCTTATTTTCTTCATTGGTGGTATGACAAGAAAGATAATACTTGCTCCATGTTTGTCTATGGTGGCT
  GCCAGGGAAACAATAACAACTTCCAATCCAAAGCCAACTGCCTGAACACCTGCAAGAATAAACGCTTTCC
  CTGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_181502
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181502.1, NP_852479.1
• RefSeq Size: 2445 bp
• RefSeq ORF: 354 bp
• Locus ID: 57119
• Cytogenetics: 20q13.12
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes an epididymal protease inhibitor, which contains both kunitz-type and WAP-type four-disulfide core (WFDC) protease inhibitor consensus sequences. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene is a member of the WFDC gene family and belongs to the telomeric cluster. The protein can inhibit human sperm motility and exhibits antimicrobial activity against E. coli, and polymorphisms in this gene are associated with male infertility. Read-through transcription also exists between this gene and the downstream WFDC6 (WAP four-disulfide core domain 6) gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (2) has an alternate and longer 5' sequence including the 5' UTR and the 5' CDS, as compared to variant 1. It encodes the shorter isoform (2), also known as eppin-2, which has a distinct N-terminus and lacks a signal peptide, as compared to isoform 1.