MAP1LC3A (NM_181509) Human Untagged Clone

CAT#: SC307290

MAP1LC3A (untagged)-Human microtubule-associated protein 1 light chain 3 alpha (MAP1LC3A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAP1LC3A
• Synonyms: ATG8E; LC3; LC3A; MAP1ALC3; MAP1BLC3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181509, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGATGAGATTCTTCAGTTCTCCATGTGGAAAAGCAGCTGTGGACCCAGCCGACCGCTGTAAGGAGG
  TACAGCAGATCCGCGACCAGCACCCCAGCAAAATCCCGGTGATCATCGAGCGCTACAAGGGTGAGAAGCA
  GCTGCCCGTCCTGGACAAGACCAAGTTTTTGGTCCCGGACCATGTCAACATGAGCGAGTTGGTCAAGATC
  ATCCGGCGCCGCCTGCAGCTGAACCCCACGCAGGCCTTCTTCCTGCTGGTGAACCAGCACAGCATGGTGA
  GTGTGTCCACGCCCATCGCGGACATCTACGAGCAGGAGAAAGACGAGGACGGCTTCCTCTATATGGTCTA
  CGCCTCCCAGGAAACCTTCGGCTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181509
• ORF Size: 378 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181509.2, NP_852610.1
• RefSeq Size: 994
• RefSeq ORF: 378
• Locus ID: 84557
• Gene Summary: MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. The protein encoded by this gene is one of the light chain subunits and can associate with either MAP1A or MAP1B. Two transcript variants encoding different isoforms have been found for this gene. The expression of variant 1 is suppressed in many tumor cell lines, suggesting that may be involved in carcinogenesis. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) which has a distinct N-terminus compared to isoform a.