KRTAP19 (NM_181609) Human Untagged Clone

CAT#: SC307320

KRTAP19 (untagged)-Human keratin associated protein 19-3 (KRTAP19-3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KRTAP19
• Synonyms: GTRHP; KAP19.3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181609, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTACTACGGCAGCTACTATGGAGGCCTGGGCTATGGCTGTGGAGGCTTTGGTGGCCTGGGCTATG
  GCTATGGCTGTGGATGTGGCAGCTTCCGCAGACTGGGTTCTGGCTGTGGCTATGGAGGCTACGGATATGG
  CTCTGGCTTTGGAGGCTATGGATATGGCTCTGGCTTCGGAGGCTACGGATATGGCTGCTACCGCCCATCA
  TACTATGGAGGATATGGATTCTCTGGATTCTATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181609
• ORF Size: 246 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_181609.3, NP_853640.1
• RefSeq Size: 494
• RefSeq ORF: 246
• Locus ID: 337970
• Protein Families: Transmembrane
• Gene Summary: In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins. [UniProtKB/Swiss-Prot Function]