GPX6 (NM_182701) Human Untagged Clone

CAT#: SC307486

GPX6 (untagged)-Human glutathione peroxidase 6 (olfactory) (GPX6) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Human Untagged Clone
• Symbol: GPX6
• Synonyms: dJ1186N24; dJ1186N24.1; GPx-6; GPX5p; GPXP3; GSHPx-6
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_182701 edited
  GTCGTCTAAAACTCCTAGCCATGTTCCAGCAGTTCCAGGCCTCCTGTCTTGTCCTGTTTT
  TCCTGGTTGGCTTTGCTCAGCAGACCCTAAAGCCTCAAAATAGGAAGGTGGATTGCAACA
  AAGGGGTAACAGGCACCATCTATGAGTATGGAGCCCTCACCCTCAACGGCGAGGAGTACA
  TCCAATTCAAGCAGTTTGCAGGCAAGCACGTCCTGTTTGTCAATGTGGCCGCCTATTGAG
  GCTTGGCAGCTCAGTATCCTGAACTGAATGCACTACAGGAGGAGCTGAAGAATTTTGGTG
  TCATTGTGTTGGCCTTTCCCTGCAACCAGTTTGGAAAACAAGAACCAGGAACAAACTCAG
  AAATACTTCTTGGTCTCAAGTATGTGTGTCCAGGTAGTGGCTTTGTCCCCAGTTTCCAGC
  TCTTTGAGAAAGGGGATGTGAATGGAGAAAAAGAACAGAAGGTCTTTACTTTCCTGAAGA
  ACTCCTGCCCTCCGACCTCTGATCTTTTGGGCTCATCAAGCCAACTCTTCTGGGAGCCCA
  TGAAGGTCCATGATATCCGCTGGAACTTTGAGAAATTTCTGGTGGGGCCCGATGGAGTCC
  CTGTCATGCATTGGTTCCACCAGGCTCCAGTCAGCACAGTCAAGTCAGACATCCTGGAGT
  ACCTAAAGCAGTTCAATACCCACTAGGAAGGGCTAGCGACTGACAGAAATAACTACCCTG
  TCTCCCACCTGCAGGAATGTCTAACAAAGCATCCATCTTCCTCCTTCTTTGCTCCACACT
  CGTGCCTACCCAGCCTCCTGATGACCAAACCATCCTGTACTACCCAAGCACCTGCTTAGC
  ATGTGTGTGTAGCTGTGTGTGTGTGTG
  
• Restriction Sites: Please inquire
• ACCN: NM_182701
• Insert Size: 900
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_182701.1, NP_874360.1
• RefSeq Size: 1712
• Locus ID: 257202
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Arachidonic acid metabolism, Glutathione metabolism
• Gene Summary: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. Expression of this gene has been observed in embryos and olfactory epithelium; however, the exact function of this gene is not known. This isozyme is a selenoprotein in humans, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The orthologs of this gene in mouse and rat (and some other species) contain a cysteine (Cys) residue in place of the Sec residue, and their corresponding mRNAs lack SECIS element. [provided by RefSeq, Jul 2017]