CREM (NM_182772) Human Untagged Clone
CAT#: SC307513
CREM (untagged)-Human cAMP responsive element modulator (CREM), transcript variant 16
"NM_182772" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CREM |
Synonyms | CREM-2; hCREM-2; ICER |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_182772, the custom clone sequence may differ by one or more nucleotides
ATGTGGTGGCATCAGCATAATCTATGTTTCAGGCGTCCTATAGAAGAGGATTATTCTTCA GGGGATGTGGAAGAAAAGGTAGCAGCAATTGCAGAGACAGATGAATCTGCAGAATCAGAA GGTGTAATTGATTCTCATAAACGTAGAGAAATCCTTTCACGAAGACCCTCTTATAGGAAA ATACTGAATGAACTGTCCTCTGATGTGCCTGGTGTTCCCAAGATTGAAGAAGAGAGATCA GAGGAAGAAGGAACACCACCTAGTATTGCTACCATGGCAGTACCAACTAGCATATATCAG ACTAGCACGGGGCAATACACTGCCACTGGTGACATGCCAACTTACCAGATCCGAGCTCCT ACTGCTGCTTTGCCACAGGGAGTGGTGATGGCTGCATCGCCCGGAAGTTTGCACAGTCCC CAGCAGCTGGCAGAAGAAGCAACACGCAAACGAGAGCTGAGGCTAATGAAAAACAGGGAA GCTGCCAAAGAATGTCGACGTCGAAAGAAAGAATATGTAAAATGTCTGGAGAGCCGAGTT GCAGTGCTGGAAGTCCAGAACAAGAAGCTTATAGAGGAACTTGAAACCTTGAAAGACATT TGTTCTCCCAAAACAGATTACTAG |
Restriction Sites | Please inquire |
ACCN | NM_182772 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182772.1, NP_877573.1 |
RefSeq Size | 1971 bp |
RefSeq ORF | 624 bp |
Locus ID | 1390 |
Cytogenetics | 10p11.21 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (16), also known as CREM theta1-beta, uses an alternative downstream promoter, differs in the 5' UTR and has multiple coding region differences, compared to variant 1. This results in a shorter isoform (16, also known as p) with a distinct N-terminus, compared to isoform 1. This isoform represents a repressor isoform theta 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216406 | CREM (Myc-DDK-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 16 |
USD 420.00 |
|
RG216406 | CREM (GFP-tagged) - Human cAMP responsive element modulator (CREM), transcript variant 16 |
USD 460.00 |
|
RC216406L3 | Lenti-ORF clone of CREM (Myc-DDK-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 16 |
USD 620.00 |
|
RC216406L4 | Lenti-ORF clone of CREM (mGFP-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 16 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review