COX8C (NM_182971) Human Untagged Clone

CAT#: SC307546

COX8C (untagged)-Human cytochrome c oxidase subunit VIIIC (COX8C), nuclear gene encoding mitochondrial protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COX8C
• Synonyms: COX8-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_182971, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTCTCCTGCGTGGGCGCTGTCCTGCCCGCCGCCACTACCGCCGCTTGGCCCTGCTCGGCCTGCAGC
  CCGCTCCCCGCTTCGCCCACTCGGGGCCCCCGCGCCAGCGGCCCCTGTCTGCCGCGGAAATGGCTGTTGG
  ACTTGTGGTGTTTTTTACGACCTTCTTAACACCAGCTGCATATGTGCTAGGCAACCTGAAGCAGTTCAGA
  AGGAATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_182971
• ORF Size: 219 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_182971.2, NP_892016.1
• RefSeq Size: 531
• RefSeq ORF: 219
• Locus ID: 341947
• Protein Families: Transmembrane
• Protein Pathways: Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]