Dectin 1 (CLEC7A) (NM_197947) Human Untagged Clone

CAT#: SC307610

CLEC7A (untagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC7A
• Synonyms: BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_197947 edited
  CTCTCAAGAACAATGGAATATCATCCTGATTTAGAAAATTTGGATGAAGATGGATATACT
  CAATTACACTTCGACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAGAGAAAGGATCG
  TGTGCTGCATCTCCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCCTATGCTTGGTA
  ATACTGGTGATAGCTGTGGTCCTGGGTACCATGGCTATTTGGAGATCCAATTCAGGAAGC
  AACACATTGGAGAATGGCTACTTTCTATCAAGAAATAAAGAGAACCACAGTCAACCCACA
  CAATCATCTTTAGAAGACAGTGTGACTCCTACCAAAGCTGTCAAAACCACAGGGGTTCTT
  TCCAGCCCTTGTCCTCCTAATTGGATTATATATGAGAAGAGCTGTTATCTATTCAGCATG
  TCACTAAATTCCTGGGATGGAAGTAAAAGACAATGCTGGCAACTGGGCTCTAATCTCCTA
  AAGATAGACAGCTCAAATGAATTGGGATTTATAGTAAAACAAGTGTCTTCCCAACCTGAT
  AATTCATTTTGGATAGGCCTTTCTCGGCCCCAGACTGAGGTACCATGGCTCTGGGAGGAT
  GGATCAACATTCTCTTCTAACTTATTTCAGATCAGAACCACAGCTACCCAAGAAAACCCA
  TCTCCAAATTGTGTATGGATTCACGTGTCAGTCATTTATGACCAACTGTGTAGTGTGCCC
  TCATATAGTATTTGTGAGAAGAAGTTTTCAATGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_197947
• ORF Size: 744 bp
• Insert Size: 800
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: It is not a varient. ORF exactly matches with reference.

Reference Data

• RefSeq: NM_197947.1, NP_922938.1
• RefSeq Size: 2592
• RefSeq ORF: 744
• Locus ID: 64581
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variant 1 has been alternatively referred to as variant 2 and isoform a has been alternatively referred to as alpha in the literature.