Dectin 1 (CLEC7A) (NM_197948) Human Untagged Clone

CAT#: SC307611

CLEC7A (untagged)-Human C-type lectin domain family 7, member A (CLEC7A), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC7A
• Synonyms: BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_197948, the custom clone sequence may differ by one or more nucleotides
  ATGGAATATCATCCTGATTTAGAAAATTTGGATGAAGATGGATATACTCAATTACACTTC
  GACTCTCAAAGCAATACCAGGATAGCTGTTGTTTCAGAGAAAGGATCGTGTGCTGCATCT
  CCTCCTTGGCGCCTCATTGCTGTAATTTTGGGAATCCTATGCTTGGTAATACTGGTGATA
  GCTGTGGTCCTGGGTACCATGGCTATTTGGAGATCCAATTCAGGAAGCAACACATTGGAG
  AATGGCTACTTTCTATCAAGAAATAAAGAGAACCACAGTCAACCCACACAATCATCTTTA
  GAAGACAGTGTGACTCCTACCAAAGCTGTCAAAACCACAGGGGTTCTTTCCAGCCCTTGT
  CCTCCTAATTGGATTATATATGAGAAGAGCTGTTATCTATTCAGCATGTCACTAAATTCC
  TGGGATGGAAGTAAAAGACAATGCTGGCAACTGGGCTCTAATCTCCTAAAGATAGACAGC
  TCAAATGAATTGATTTCAGATCAGAACCACAGCTACCCAAGAAAACCCATCTCCAAATTG
  TGTATGGATTCACGTGTCAGTCATTTATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_197948
• ORF Size: 570 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_197948.1, NP_922939.1
• RefSeq Size: 2473
• RefSeq ORF: 570
• Locus ID: 64581
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks an alternate exon, which results in a frameshift and an early stop codon, compared to variant 1. The resulting protein (isoform c) is shorter and has a distinct C-terminus, compared to isoform a.